ID: 1146774156

View in Genome Browser
Species Human (GRCh38)
Location 17:35597082-35597104
Sequence CTGCCTCAGTGGCCCCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146774156_1146774160 -1 Left 1146774156 17:35597082-35597104 CCGCTCCGGGGCCACTGAGGCAG 0: 1
1: 0
2: 2
3: 27
4: 203
Right 1146774160 17:35597104-35597126 GCAGTAGCGACCTCCGGAAGCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1146774156_1146774159 -7 Left 1146774156 17:35597082-35597104 CCGCTCCGGGGCCACTGAGGCAG 0: 1
1: 0
2: 2
3: 27
4: 203
Right 1146774159 17:35597098-35597120 GAGGCAGCAGTAGCGACCTCCGG 0: 1
1: 1
2: 1
3: 7
4: 133
1146774156_1146774163 26 Left 1146774156 17:35597082-35597104 CCGCTCCGGGGCCACTGAGGCAG 0: 1
1: 0
2: 2
3: 27
4: 203
Right 1146774163 17:35597131-35597153 TGTCCCCACTGTTTCTATGCTGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146774156 Original CRISPR CTGCCTCAGTGGCCCCGGAG CGG (reversed) Intronic
900985765 1:6072110-6072132 GTGCCTCAGTGGCCCCGGGAAGG + Intronic
904594180 1:31632696-31632718 CTGCCTCAATGGGTCCTGAGGGG - Intronic
904652212 1:32014113-32014135 CTGCCTCACCGGTCCCGGGGAGG + Exonic
905800514 1:40839492-40839514 CTGCTGCAGAGGCCCAGGAGCGG - Exonic
908826916 1:68141959-68141981 CTGCGACAGTCGGCCCGGAGTGG - Intronic
912433090 1:109640026-109640048 ATGCCTCAGTGTCCCCAGAGTGG + Intergenic
912508676 1:110173938-110173960 CAGCCTCAGTGACCCCGCAGTGG + Intronic
913121861 1:115749708-115749730 CTGCCCCACTGGCCCAGCAGAGG - Intronic
915345113 1:155193313-155193335 CTGCTTCAGTGGACCCGGGGAGG - Intergenic
915549581 1:156624507-156624529 CTGTCTCAGGGGCCCGAGAGAGG + Intronic
919761182 1:201099205-201099227 CTGCCTCTGTGGTCCCAGATAGG - Intronic
919791218 1:201292109-201292131 CTGCCTCAGGGTCCTCTGAGAGG - Intronic
919797386 1:201329438-201329460 CTGACTCAATAGCCCTGGAGTGG + Intronic
920049302 1:203153696-203153718 CTGCTTCAGGGGCCCTGGGGAGG - Intronic
920180100 1:204127216-204127238 CAGCGTCAGAGGCCCTGGAGAGG + Exonic
922200123 1:223394029-223394051 CTTCCTCAGTTCCCTCGGAGCGG + Exonic
923337074 1:232979745-232979767 ATGCCTCAGTGGGCCAGGAGAGG + Exonic
1063829825 10:9940190-9940212 CTGCCTCACTGGGCCAGGTGGGG + Intergenic
1064478647 10:15718974-15718996 CTGCCCCAGTGTCCCCGGGCAGG - Intronic
1065825458 10:29566732-29566754 CTGACTCAGAGGCCCCCCAGCGG + Intronic
1069824018 10:71244318-71244340 ATGCCTGAGTGGCCCTGGGGTGG - Intronic
1071813556 10:89208410-89208432 CGGGCTCCGTGGGCCCGGAGTGG - Intergenic
1072622791 10:97090957-97090979 CTGCCTCACTGCCCCAGGAGGGG + Intronic
1073123730 10:101136946-101136968 AGGCCTCAGTGACCCCTGAGTGG - Exonic
1074954021 10:118370000-118370022 CTGCCTGAAGGGCCTCGGAGAGG + Intergenic
1076231388 10:128822648-128822670 CTGCCTCTCTGGCTCCTGAGTGG - Intergenic
1076800790 10:132827142-132827164 GTGGCTCAGTGGCCCAGGACTGG - Intronic
1077170693 11:1164660-1164682 CAGCCTCAGCGGCCCAGGACAGG - Intronic
1077170714 11:1164725-1164747 CAGCCTTAGGGGCCCAGGAGAGG - Intronic
1077170731 11:1164790-1164812 CAGCCTCAGGGGCCCGGGACAGG - Intronic
1077170744 11:1164822-1164844 CAGCCTCAGGGGCCCAGGACAGG - Intronic
1077170766 11:1164887-1164909 CAGCCTCAGGGGCCCGGGACAGG - Intronic
1077170787 11:1164952-1164974 CAGCCTCAGGGGCCCGGGACAGG - Intronic
1077170800 11:1164984-1165006 CAGCCTCAGGGGCCCGGGACAGG - Intronic
1077170824 11:1165049-1165071 CAGCCTCAGGGGCCCAGGACAGG - Intronic
1077170848 11:1165113-1165135 CAGCCTCAGGGGCCCGGGACAGG - Intronic
1077170860 11:1165145-1165167 CAGCCTCAGGGGCCCGGGACAGG - Intronic
1077984759 11:7340796-7340818 CTGGCTCAGTAGCCCCAGTGGGG + Intronic
1079107293 11:17579641-17579663 CTGCCACTTGGGCCCCGGAGTGG + Intronic
1081099693 11:38986585-38986607 CTGCCTCAGTGGCCACAGCCTGG + Intergenic
1081651749 11:44828512-44828534 CTGCGGCAGGGGCCCCGGAAAGG + Intronic
1083335318 11:61918431-61918453 CTGAGTCAGTGGGCCTGGAGGGG - Intronic
1083949773 11:65947525-65947547 CTGCCCCAGCGCCCCAGGAGGGG + Exonic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084335536 11:68455533-68455555 CTGCCTCAGTGCCCCAGGGCAGG - Intergenic
1085192362 11:74638774-74638796 CTGCATCAGTAGGCCAGGAGTGG + Intronic
1085413451 11:76305522-76305544 CTGCCTCTGGGGCCCTGGAGGGG + Intergenic
1089312733 11:117570765-117570787 GACCCTCAGTGGCCCCTGAGTGG - Intronic
1089641996 11:119853826-119853848 CTGCCTCTGTGGCCTGTGAGTGG + Intergenic
1089780018 11:120867112-120867134 CTGTCTCTGTGGCCTCCGAGAGG + Intronic
1090442242 11:126734069-126734091 CTGCCTCAGTAGTTCTGGAGTGG - Intronic
1091394919 12:148275-148297 CTGATTCAGTGGGCCTGGAGCGG - Intronic
1092138545 12:6166975-6166997 CTGCCTCAGTGGCCAGCGTGGGG - Intergenic
1093169923 12:15848985-15849007 CTGCCACAATGGCCCAGGAAGGG + Intronic
1094784449 12:33830056-33830078 CTGCCTCACAGGCCCCAGGGAGG - Intergenic
1096257759 12:50073416-50073438 CTGCCACAGAGGCCCTGGTGAGG + Intronic
1096868911 12:54581134-54581156 ATACCCCAGTGGCCCCTGAGAGG + Intronic
1100504200 12:95204156-95204178 CTGCCTCTGAGAACCCGGAGCGG + Intronic
1102895861 12:116598144-116598166 CTGAATCAGTGGCACTGGAGAGG + Intergenic
1103983950 12:124754961-124754983 CTGACTCAGTGGTCCTGGAGAGG + Intergenic
1104391769 12:128397111-128397133 CAGCCTCACTGGCCCCAGGGTGG + Intronic
1104802936 12:131566968-131566990 CTGCCCCTGTGGCCCCCGTGAGG + Intergenic
1105291303 13:19055408-19055430 CAGTCTCAGTGGCCCCAGGGTGG + Intergenic
1105767868 13:23579168-23579190 CCGCTTCAGTAGCCGCGGAGTGG + Intronic
1105843357 13:24274373-24274395 CTGACTCAGTGGCCCAGGGCAGG + Intronic
1106033717 13:26025333-26025355 CTGCCTGCGTGGCCCTTGAGAGG - Exonic
1112419872 13:99238562-99238584 CTGCCTCATTGGCCCCTGAGAGG + Intronic
1113617834 13:111693754-111693776 CTGCCACAGTTGCACAGGAGAGG + Intergenic
1113623367 13:111779015-111779037 CTGCCACAGTTGCACAGGAGAGG + Intergenic
1114216023 14:20658389-20658411 GTGCCTCAGTGGTCTCGGAGTGG - Intergenic
1114416013 14:22544951-22544973 CTTCCTCAGTGGGCTCTGAGAGG + Intergenic
1120836275 14:89040873-89040895 CTGCCTCCCTGGCCCGGGACTGG - Intergenic
1121494000 14:94379484-94379506 CCTCCTCTGTGACCCCGGAGAGG + Exonic
1122776491 14:104119199-104119221 CTGGCCCAGTGGCCCAGGGGAGG - Intergenic
1124651705 15:31478893-31478915 CTGCCTCACTGACTCGGGAGTGG - Exonic
1124652483 15:31483927-31483949 CTGCGTGGGTGGGCCCGGAGAGG + Exonic
1127291327 15:57573948-57573970 CTCACTCAGAGGCCCAGGAGTGG - Intergenic
1128318010 15:66673342-66673364 GTGCCTCAGAGGCCTCAGAGAGG - Intronic
1130042838 15:80419287-80419309 CTGCCTCAGTGGACCTGAAGGGG - Intronic
1130229031 15:82082430-82082452 CAGACTCTGTGGCCCAGGAGTGG + Intergenic
1130808492 15:87352420-87352442 CTGCCCCACTGGCCCTGCAGAGG - Intergenic
1131581740 15:93649892-93649914 GCGCCTCAGAGGCCCCGGGGAGG - Intergenic
1132657595 16:1047898-1047920 CTGCCTGAGTGGCCCCACAGTGG - Intergenic
1132977046 16:2716111-2716133 GTGCCTCCGTGGCCCCCAAGAGG - Intronic
1133729707 16:8569109-8569131 CTGCCCCAGGGGACCCGGATGGG + Intergenic
1134093174 16:11402273-11402295 CTGGCTGTGTGGCCCCCGAGTGG - Intronic
1134514261 16:14874033-14874055 CTGCTACAGTGACCCCAGAGGGG - Intronic
1134514280 16:14874109-14874131 CTGCTGCAGTGACCCCAGAGGGG - Intronic
1134635582 16:15789408-15789430 TTGCCTCAGTTTCCCCGGATGGG - Intronic
1134701901 16:16272531-16272553 CTGCTACAGTGACCCCAGAGGGG - Intronic
1134701920 16:16272606-16272628 CTGCTGCAGTGATCCCGGAGGGG - Intronic
1134969911 16:18522044-18522066 CTGCTGCAGTGATCCCGGAGGGG + Intronic
1134969930 16:18522119-18522141 CTGCTACAGTGACCCCAGAGGGG + Intronic
1135480095 16:22814772-22814794 CTGCCTCCGCGGCCCCAGCGCGG + Exonic
1135841621 16:25882046-25882068 CTGCCTCAGTTTCCCCAAAGAGG - Intronic
1136506088 16:30704206-30704228 GTGCCACAGTGCCCCTGGAGGGG + Exonic
1137511892 16:49107900-49107922 CATCCTCTGTGGCCCTGGAGTGG - Intergenic
1137566746 16:49538069-49538091 CTGCCTCTGTGGGTCAGGAGTGG - Intronic
1139393741 16:66623165-66623187 CTGACTCAGTAGCTCTGGAGCGG + Intronic
1140052022 16:71489689-71489711 CTTCCTCAATGGCCCGTGAGTGG - Intronic
1141432508 16:83977704-83977726 CTGCATCTGTGGCCTGGGAGAGG + Intronic
1142380545 16:89729557-89729579 CTGCCTCAGAGTCCCAGCAGTGG + Intronic
1142398942 16:89849165-89849187 TTGCCTCAGTGGCCCTGCAGGGG - Intronic
1142493245 17:292260-292282 CTGCCCCAGTGGGCCAGCAGCGG + Intronic
1144490620 17:15704982-15705004 CTGCCGCTGCGGCCCTGGAGAGG + Intronic
1145273918 17:21418858-21418880 CTGTCTCACTGGCCCTGGAAGGG - Exonic
1146459375 17:33033529-33033551 CACCCTCAGTGGCCCCAGAAGGG + Intronic
1146774156 17:35597082-35597104 CTGCCTCAGTGGCCCCGGAGCGG - Intronic
1148352094 17:46948563-46948585 CAGCCTCAGTGTCCTCGTAGGGG + Intronic
1148452689 17:47790210-47790232 CGGGCCCAGTGGCCGCGGAGCGG - Intergenic
1150601016 17:66651048-66651070 GAGCCTCAGTGGCCCTGGGGAGG + Intronic
1151909026 17:77069237-77069259 CTGCCTCAGTTTCCCCAGTGTGG - Intergenic
1152590308 17:81208455-81208477 CTGCCTCAATGGCCCCAGTGGGG - Intronic
1152740312 17:82015805-82015827 CTGCCCGAGTGGCCCTGGAGAGG - Intronic
1158589715 18:58768989-58769011 CTGCCCCAGGGGCCCCAGATGGG - Intergenic
1161104650 19:2437243-2437265 CTGCCTCCGGGGGCTCGGAGAGG - Intronic
1163273775 19:16269761-16269783 CTGTCTCAGGGGCACAGGAGTGG + Intergenic
1164914228 19:32037574-32037596 CTGTCTCTGGGGCCCTGGAGAGG + Intergenic
1165418956 19:35713310-35713332 CTGCCACAGTCCCCCCGAAGGGG - Intronic
1165559710 19:36668321-36668343 CTCCCGCAGTGGCCCCTGTGGGG + Intergenic
1165781698 19:38438422-38438444 CTGTCTCAGGGGCCCCAGGGAGG + Intronic
1166921655 19:46232665-46232687 TCGCCTCAGTGGCCCCAGACGGG + Intergenic
1167045919 19:47048523-47048545 CCGCCTCAGCGGCCCCGGAGCGG - Exonic
1167436388 19:49481062-49481084 CTGTCTCCGTGGCCCCAGAGGGG - Intronic
1167494485 19:49809548-49809570 CGGCCTCAGCGAACCCGGAGAGG + Exonic
1168301546 19:55407672-55407694 CTGCCGCTGCGGCCCTGGAGAGG + Exonic
1168536819 19:57177729-57177751 CTACCTCAGTGGCCTGGGAGGGG - Intergenic
926723791 2:15982169-15982191 CTCCCTCACTGGTCCTGGAGAGG + Intergenic
927093252 2:19728416-19728438 CTGCCCCAGTGGCCCCAAGGCGG - Intergenic
927110676 2:19861741-19861763 CTGACTCAGGGGCCCAGGACTGG - Intergenic
927714043 2:25341428-25341450 CTGCCGCAGGGGCCCCGGCCGGG - Intronic
929536444 2:42787206-42787228 GTGCCTGAGTGTCCCCTGAGGGG - Intronic
930762292 2:55049989-55050011 CTCCCCCCGTCGCCCCGGAGCGG - Exonic
933870599 2:86562379-86562401 CTGACTCAGTGGGTCTGGAGTGG + Intronic
934898084 2:98135862-98135884 CTGCCTCTGAGGCCCAGGTGAGG - Intronic
935687735 2:105698909-105698931 CTGACTCAGTGGACCTGGAGTGG + Intergenic
937243606 2:120478044-120478066 CTGCCTGAGTGGCCCAAGAGAGG - Intergenic
940841162 2:158583344-158583366 CTGCTTCAGTGTCCTTGGAGTGG - Intronic
947990010 2:234479304-234479326 CTGCCTCAGTGGGCGTGGAAGGG + Intergenic
948823723 2:240564251-240564273 CCACCTCAGTGGCCCTGAAGTGG + Intronic
948944044 2:241210409-241210431 CTGCCTCGGGGGGCCCTGAGCGG + Intronic
1168833540 20:860831-860853 CAGCATCAATGGCCCAGGAGGGG + Intergenic
1169075173 20:2755793-2755815 CTGCCCCAGAGCCCACGGAGAGG + Exonic
1172203886 20:33148262-33148284 CTTCCTCAGTGGCTCCACAGTGG + Intergenic
1173166348 20:40689403-40689425 CGGCCCGAGCGGCCCCGGAGCGG + Intergenic
1173883702 20:46438607-46438629 CTGTCTCAGAGGCCAGGGAGGGG - Intergenic
1176160412 20:63644739-63644761 CCTCCTAAGTGGCCCCAGAGTGG + Intronic
1178350001 21:31866116-31866138 CTGCCTCCGTGGCCCTGGGCAGG - Intergenic
1179157454 21:38862795-38862817 ATTCCTCAGGGGCCCCTGAGTGG - Intergenic
1179623342 21:42633013-42633035 CTGGCCCAGTGGTCCCGGTGTGG - Intergenic
1180830320 22:18902420-18902442 CTGCCTCACTGGCCCTGGTGAGG - Intergenic
1181069392 22:20323113-20323135 CTGCCTCACTGGCCCTGGTGAGG + Intergenic
1181510990 22:23388631-23388653 CTTCCCCAGTGGCCCCGAGGGGG - Intergenic
1181536442 22:23548733-23548755 CTGCTTCTGAGGCCCCAGAGAGG - Intergenic
1181680834 22:24494944-24494966 CTCCCTCAGGGGCCCTGGCGCGG - Intronic
1182124284 22:27805008-27805030 CACACTCAGTGCCCCCGGAGGGG - Intergenic
1182605148 22:31497007-31497029 CCGGCTCCGTGGCCCAGGAGCGG + Intronic
1183662615 22:39230454-39230476 CCCCCTCAGTGCCCCCAGAGAGG + Intronic
1183974373 22:41502320-41502342 CTGACTCAGTGGGTCTGGAGTGG - Intronic
1184034772 22:41913197-41913219 CTGCCTCTGAGGCCCAGGAGGGG + Intronic
1184365400 22:44047916-44047938 CTGACTCAGGGGAGCCGGAGGGG - Intronic
1184453660 22:44597314-44597336 CTGACTCAATGGCCCGGGACAGG + Intergenic
1203280409 22_KI270734v1_random:127691-127713 CTGCCTCACTGGCCCTGGTGAGG - Intergenic
952750912 3:36824213-36824235 CTGCCTCTGTTTCCCTGGAGTGG - Intergenic
954654241 3:52184241-52184263 CTGCCTCAGGGGCCCCTTTGAGG + Intergenic
961168555 3:124780086-124780108 CTGCCTCAGAGGCCTCGCTGAGG - Intronic
961168581 3:124780163-124780185 CTGCCTCAGAGGCCCTGCTGAGG - Intronic
961313387 3:126017816-126017838 CTGCCTCAGGTGCCCCAGACTGG + Intronic
961424584 3:126835115-126835137 CAGCCTCTGGGGCCCCTGAGGGG + Intronic
961645708 3:128391761-128391783 CTGCCTGAGTGGGCCAGGTGGGG - Intronic
963063394 3:141242805-141242827 CTGCCTCAGGGGGCATGGAGGGG - Intronic
964113431 3:153110785-153110807 CTGCCTCAGTGCCCCCATACAGG + Intergenic
966442182 3:179957887-179957909 CTGCCCCAGTGGCCTCAGAATGG + Intronic
968490574 4:888723-888745 CTGCCTCAGGGGCCCCTGTGGGG + Intronic
968658768 4:1790071-1790093 CTGCCTCAAAGGCCCCAGAAGGG + Intergenic
969316282 4:6383187-6383209 CTGGCCCACTGGCCCCTGAGGGG + Intronic
969422013 4:7103034-7103056 CTGCCTCTGCGGCCCTGGACAGG - Intergenic
969616890 4:8258450-8258472 GTGCCTCAGTGTCCTCTGAGTGG + Intergenic
969669569 4:8582260-8582282 CTGCCTCAGTTGCCTCTGTGTGG + Intronic
970581438 4:17477549-17477571 CTGCCTCAGTGGCATCTCAGGGG - Intronic
972181910 4:36477083-36477105 CTGCCTCAATGGTCCCTGAAAGG - Intergenic
972578310 4:40372387-40372409 CTGCATCAGAGACCCTGGAGGGG + Intergenic
972581913 4:40402774-40402796 CTGCCTCAGGGACCCAGGTGTGG + Intergenic
985226421 4:187765891-187765913 CTGCCTCAGTTACCCGGGTGGGG - Intergenic
995417588 5:111927183-111927205 AGGCCTCAGTGGCGCAGGAGAGG - Intronic
997356365 5:133265509-133265531 CTGCCCCAGAGGCCCCAGACAGG - Intronic
997781788 5:136667078-136667100 CTCCCACAGTGGCCCCTTAGTGG + Intergenic
999063017 5:148655186-148655208 AGGCCTCAGTGGCCCTTGAGGGG - Intronic
999648906 5:153746568-153746590 CTGCCTCAGTGGGCCAGGTGTGG - Intronic
1001294427 5:170489129-170489151 CTGACCCAATGGCCCCGGAATGG + Intronic
1004319738 6:14622934-14622956 CTGACTCAGTAGGTCCGGAGTGG - Intergenic
1004324437 6:14661893-14661915 CTGCCTCAGCGACTTCGGAGTGG - Intergenic
1006610212 6:35290142-35290164 CTGCCCCAGAGGCCCCTGACAGG + Intronic
1006682363 6:35806116-35806138 CTGCAGCTGTGGCCCCGGGGTGG - Intronic
1007298765 6:40849690-40849712 ATGCCTCTGTAGCCCCGCAGAGG - Intergenic
1007408926 6:41650344-41650366 CTGCCCCTGTGGCCCTGCAGAGG - Intronic
1009056977 6:58347972-58347994 CTGCCTCAATGGCCCCTGATGGG + Intergenic
1009234266 6:61103597-61103619 CTGCCTCAATGGTCCCTGATGGG - Intergenic
1013611429 6:111799701-111799723 CTGCCTCAGTGGCTCTGGACAGG - Intronic
1018391689 6:163346030-163346052 CTGACTCAGTGGCCCCAGCGAGG - Intergenic
1018898669 6:168039493-168039515 CTGCCTCCGGGGCCCAGGATGGG - Intronic
1019161195 6:170067929-170067951 TTGCCACAGTGGCCAGGGAGAGG - Intergenic
1019175382 6:170156857-170156879 CTGCCTCTGTGGCCCATGTGTGG - Intergenic
1019742995 7:2684408-2684430 CTGCCTCAGTTTCCCCAGGGTGG - Intronic
1020993603 7:15233418-15233440 CTCCCTCAGTCTCCCTGGAGAGG - Intronic
1030675025 7:112375488-112375510 CTCCCTGAGTTGCCCCGGGGAGG - Intergenic
1032397911 7:131603969-131603991 CTGCCCCAGTGTTCCCTGAGGGG - Intergenic
1035607383 8:938823-938845 TTGCCTCAGAGGCCAAGGAGAGG + Intergenic
1036636982 8:10557897-10557919 CTGACTCTGGGTCCCCGGAGAGG - Intergenic
1038010569 8:23472583-23472605 GTGCCTCAGTGGCCAGGGACAGG + Intergenic
1041891124 8:62869878-62869900 CTGCCTCAGCCCCCCCGAAGTGG + Intronic
1042216403 8:66432761-66432783 CTGCCTCACTGCGCCCTGAGAGG - Intronic
1045293151 8:100850909-100850931 ATGCCTCAGAGGCCTCAGAGAGG + Intergenic
1049072602 8:140368430-140368452 CTGCCCCTGTGGCTCCAGAGAGG + Intronic
1049396468 8:142403265-142403287 CCGCCCCAGAGGCCCCGGCGCGG + Intergenic
1049402451 8:142434575-142434597 CTGCCTCAGTAGCCCAAGGGAGG - Intergenic
1049488137 8:142876978-142877000 CAGCCTCAGAGACCCTGGAGTGG - Intronic
1049696806 8:143988050-143988072 CTGCCTCAGTAGCCTGGGACTGG + Intronic
1049709194 8:144056084-144056106 CTGCACCAGGGGCCCCGCAGTGG + Intronic
1053100409 9:35366971-35366993 CTGCCTCAGTGGCTCCCGGAAGG + Exonic
1053481941 9:38422615-38422637 CTCCCTGAGTGGCCCTGGACGGG - Intronic
1057196961 9:93120781-93120803 CTGCCTCTGTGTCCCCGCTGTGG - Intergenic
1059256128 9:112932902-112932924 CTGCCACTGTGGCCCCAAAGTGG + Intergenic
1061264131 9:129495958-129495980 CTGCCTCCGCGGCCCCCAAGCGG - Intergenic
1061285702 9:129621234-129621256 CTGCCTCAGAGACCCCTGGGTGG + Intronic
1061896954 9:133653194-133653216 CTGACTCAGTGGGCCTGGGGTGG - Intronic
1062189812 9:135242229-135242251 CTGCCTGGGTGGCCTTGGAGGGG - Intergenic
1062238297 9:135523053-135523075 CTGCCGCATGGGACCCGGAGGGG + Intronic
1062381385 9:136288466-136288488 CTGGCTCAGAGGCCAGGGAGGGG - Intronic
1190379822 X:49829003-49829025 CTACCTCAGTGGCCCTTAAGAGG - Intergenic
1191830249 X:65407745-65407767 CGGCCTCAGTCGCCCGGGCGGGG - Intronic
1193649125 X:84109070-84109092 CTGTCTCCTTGGCCCAGGAGTGG - Intronic
1199635069 X:149806313-149806335 CTGCCTCCCAGGCCCCAGAGAGG + Intergenic