ID: 1146775367 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:35609716-35609738 |
Sequence | CTGAGGAAGGCCAAGGTGGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 110890 | |||
Summary | {0: 1, 1: 15, 2: 1322, 3: 26848, 4: 82704} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1146775367_1146775373 | -6 | Left | 1146775367 | 17:35609716-35609738 | CCTCCCACCTTGGCCTTCCTCAG | 0: 1 1: 15 2: 1322 3: 26848 4: 82704 |
||
Right | 1146775373 | 17:35609733-35609755 | CCTCAGTGAATTACTGTGCTTGG | 0: 1 1: 0 2: 2 3: 13 4: 161 |
||||
1146775367_1146775375 | 25 | Left | 1146775367 | 17:35609716-35609738 | CCTCCCACCTTGGCCTTCCTCAG | 0: 1 1: 15 2: 1322 3: 26848 4: 82704 |
||
Right | 1146775375 | 17:35609764-35609786 | TTTTCTTAGTGAACTTTAAATGG | 0: 1 1: 0 2: 6 3: 53 4: 805 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1146775367 | Original CRISPR | CTGAGGAAGGCCAAGGTGGG AGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |