ID: 1146775367

View in Genome Browser
Species Human (GRCh38)
Location 17:35609716-35609738
Sequence CTGAGGAAGGCCAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110890
Summary {0: 1, 1: 15, 2: 1322, 3: 26848, 4: 82704}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146775367_1146775373 -6 Left 1146775367 17:35609716-35609738 CCTCCCACCTTGGCCTTCCTCAG 0: 1
1: 15
2: 1322
3: 26848
4: 82704
Right 1146775373 17:35609733-35609755 CCTCAGTGAATTACTGTGCTTGG 0: 1
1: 0
2: 2
3: 13
4: 161
1146775367_1146775375 25 Left 1146775367 17:35609716-35609738 CCTCCCACCTTGGCCTTCCTCAG 0: 1
1: 15
2: 1322
3: 26848
4: 82704
Right 1146775375 17:35609764-35609786 TTTTCTTAGTGAACTTTAAATGG 0: 1
1: 0
2: 6
3: 53
4: 805

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146775367 Original CRISPR CTGAGGAAGGCCAAGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr