ID: 1146775406

View in Genome Browser
Species Human (GRCh38)
Location 17:35610113-35610135
Sequence TACCATATGGTGTTACTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146775406_1146775411 11 Left 1146775406 17:35610113-35610135 CCCCTAAGTAACACCATATGGTA 0: 1
1: 0
2: 1
3: 10
4: 133
Right 1146775411 17:35610147-35610169 TTTTTTATTTTTTTTTGAGATGG 0: 230
1: 86262
2: 70255
3: 104627
4: 368091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146775406 Original CRISPR TACCATATGGTGTTACTTAG GGG (reversed) Intronic
907659136 1:56375744-56375766 TACCATACGGGGTTACTAGGAGG + Intergenic
909338598 1:74506051-74506073 TAGCATCTGGTGACACTTAGTGG - Intronic
910500374 1:87883437-87883459 TACCATATTGTTTTAATTAATGG + Intergenic
911736843 1:101345960-101345982 TACCACATGTTCTCACTTAGTGG - Intergenic
912024753 1:105155393-105155415 TACCATAAGATGGTACTTAGTGG - Intergenic
914957775 1:152179860-152179882 TGCCATATGGTGTGACTAAATGG + Intergenic
917172806 1:172196134-172196156 TACCATATGTTCTCACTTATCGG - Intronic
917577428 1:176338665-176338687 TACCATATGATATTAATTTGGGG - Intergenic
917689513 1:177453398-177453420 TACCACATGTTGTCACTTAATGG - Intergenic
919290683 1:195626026-195626048 TACCATATAGTTCTTCTTAGAGG + Intergenic
919631257 1:199962191-199962213 TACCACATGGGGTTACTGTGAGG - Intergenic
919816170 1:201441383-201441405 TTGCATATGGTGTTACGTAAGGG - Intergenic
1063023509 10:2154823-2154845 TACCAAATGGTGTTACCAAATGG + Intergenic
1064342781 10:14501590-14501612 CACCATATGGACATACTTAGAGG - Intergenic
1064779887 10:18823643-18823665 TACCATATGTTCTCACTTAATGG - Intergenic
1065079354 10:22112314-22112336 TAACACATGAAGTTACTTAGAGG + Intergenic
1068702776 10:60037520-60037542 TACCATATGTTCTCATTTAGTGG - Intronic
1072085938 10:92079241-92079263 TAACACATGGTGCTACTTGGAGG - Intronic
1073676870 10:105657743-105657765 TACCATGTTTAGTTACTTAGAGG - Intergenic
1075543445 10:123335377-123335399 TACCACATGTTCTCACTTAGTGG - Intergenic
1077461093 11:2710649-2710671 TAACATATGGTGTGAGGTAGGGG + Intronic
1080732567 11:34974583-34974605 TACCATACTGTTTTCCTTAGTGG + Intronic
1086283527 11:85218987-85219009 TACCACATGTTCTTACTTATAGG + Intronic
1087603271 11:100342818-100342840 TGCCATTTGTTGTTGCTTAGAGG + Intronic
1087665771 11:101045914-101045936 CTCCATATGGTGTTCCATAGAGG + Intronic
1092270851 12:7022112-7022134 TACAATATGATGTTATCTAGAGG - Intronic
1092950171 12:13495382-13495404 TGCCAAATAGTGTTACTTAGAGG + Intergenic
1096281586 12:50259614-50259636 TAACATTTGATGTTATTTAGTGG - Intronic
1099173122 12:79389498-79389520 TACCATATAGGGTTACTGTGAGG - Intronic
1100705088 12:97191876-97191898 TACTATATTGTGTAAATTAGTGG + Intergenic
1101742665 12:107513067-107513089 TACCATATAGTGTGGCTGAGAGG + Intronic
1102805862 12:115779772-115779794 TACCACATGTTCTTACTTATGGG + Intergenic
1103198039 12:119062912-119062934 TACCTTATGGGGTTACTGTGTGG + Intronic
1105687513 13:22799944-22799966 TACCACACGTTCTTACTTAGAGG + Intergenic
1106977870 13:35243971-35243993 TAACATATGGTCTAACCTAGAGG - Intronic
1107524689 13:41218871-41218893 TACTATATGCTGGTACTTTGGGG - Intronic
1107649648 13:42531724-42531746 TACCATAGCATGTTATTTAGAGG + Intergenic
1109510450 13:63365268-63365290 TACCATAATGTGTTTCATAGAGG - Intergenic
1109884935 13:68529423-68529445 TACCACATGTTCTTACTTATAGG + Intergenic
1111272499 13:85904859-85904881 TACCACATGTTCTCACTTAGTGG + Intergenic
1111890436 13:94075055-94075077 TCCCATGTGTTGTAACTTAGGGG - Intronic
1114054519 14:18955569-18955591 TACCACATGTTCTCACTTAGGGG - Intergenic
1114108034 14:19446362-19446384 TACCACATGTTCTCACTTAGGGG + Intergenic
1114698422 14:24649933-24649955 TACTATATGGTCTATCTTAGAGG - Intergenic
1115559437 14:34569951-34569973 TGCCATATGGTTTTCCATAGTGG + Intronic
1116529588 14:45952780-45952802 TAGCATACGGTGTTACTTTTGGG + Intergenic
1117432160 14:55678330-55678352 TACCATATTGTTTTCCTTATAGG + Exonic
1120932839 14:89866237-89866259 TGCCATACGGTGTCATTTAGGGG - Intronic
1120969398 14:90194736-90194758 TACCCTTTGGAGTTCCTTAGAGG + Intergenic
1122170948 14:99875194-99875216 TTGCAGATGGTGTTAATTAGGGG + Intronic
1123964448 15:25440596-25440618 TAGCATATGGAGATACTTATAGG + Intergenic
1124898175 15:33797019-33797041 TACCACATGTTCTCACTTAGTGG + Intronic
1130807582 15:87342434-87342456 TAAAATATGGTGTCCCTTAGTGG + Intergenic
1131515700 15:93074849-93074871 TAGCAAATGGTGTTAATTAGTGG - Intronic
1131545976 15:93315832-93315854 TACCTTATGGTGTCACTTAATGG - Intergenic
1138465646 16:57187488-57187510 TACCATCTGTTCTTGCTTAGTGG + Intronic
1139235212 16:65331009-65331031 TACCATATGCTTTTCCTTAGAGG + Intergenic
1142540278 17:653590-653612 TACTATATGGTGTCACCTTGAGG - Intronic
1146775406 17:35610113-35610135 TACCATATGGTGTTACTTAGGGG - Intronic
1147278104 17:39335698-39335720 AACCATATGTACTTACTTAGCGG - Intronic
1148400359 17:47354289-47354311 TACCATATGGTCTATCTTGGAGG + Intronic
1149807666 17:59634215-59634237 TACCAAATGGGCTTACTTTGAGG - Intronic
1151025336 17:70670629-70670651 TACCATATGGTGTTAGTACTAGG - Intergenic
1151494090 17:74449344-74449366 TACCATCTCGTTTTACTTTGTGG - Intronic
1152314034 17:79569657-79569679 TTCCATTTGCTGTTACTTAGCGG + Intergenic
1160124441 18:76157457-76157479 TACCATAGGGTCTTACTTTTTGG + Intergenic
1160177165 18:76604600-76604622 TACGTTATGGTGTTACTGATGGG + Intergenic
1163973767 19:20828395-20828417 TAACATATGGTGTTTGTTACTGG - Intronic
1167791339 19:51684561-51684583 TACCATTTGGGGTTATTTAATGG + Intergenic
1168439444 19:56351343-56351365 GAACACATGGTGTTACTTGGAGG - Intronic
926235010 2:11034450-11034472 TACCATATATTCTTACTTACAGG - Intergenic
928698583 2:33875813-33875835 TTGCATATGGTGTTATGTAGGGG + Intergenic
929063958 2:37953763-37953785 TACCATATTGTTTTCCATAGTGG + Intronic
934607456 2:95707863-95707885 TACCTTATAGTGTTATTTTGAGG + Intergenic
936707653 2:115094460-115094482 TACCATGTGATGTAAGTTAGAGG - Intronic
936835414 2:116703722-116703744 TACCATATGGAGTTCCTAAGTGG - Intergenic
938858753 2:135343564-135343586 GACCATGTGGTGTTATTTAAAGG + Intronic
940519559 2:154726931-154726953 TATCATATGTTTTTACTTATTGG + Intronic
943162195 2:184268929-184268951 TAACATACGGTGTTATTTGGAGG + Intergenic
943848085 2:192677213-192677235 TACTATATGGTGTTTATTTGGGG + Intergenic
943927017 2:193798086-193798108 TACAATATTGTGTTACTATGAGG - Intergenic
944970769 2:204990886-204990908 TAGCATATGGTGTGAGATAGGGG + Intronic
948349798 2:237329756-237329778 TAGCATTTTGTGTTACTTAGTGG - Intronic
1170143232 20:13146188-13146210 TACCACATGTTCTTACTTATAGG + Intronic
1171186756 20:23128441-23128463 AACCATATGGTCTTCCTTATGGG - Intergenic
1178554963 21:33581782-33581804 CACCATTTGTTGATACTTAGGGG + Intronic
1180472989 22:15677961-15677983 TACCACATGTTCTCACTTAGGGG - Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
953243273 3:41168186-41168208 TAAGCCATGGTGTTACTTAGAGG + Intergenic
953772543 3:45789935-45789957 TAACATATGGTGTGAGTTTGGGG - Intronic
955994683 3:64667818-64667840 TACCATATCGGGTTGCTTTGAGG - Intronic
957123300 3:76125075-76125097 TACCACATGGTCTCACTTATAGG - Intronic
957289824 3:78265500-78265522 TACCATATGGTTTATCTTGGAGG + Intergenic
957971924 3:87392988-87393010 TATCATATGGTGTATCTTGGAGG - Intergenic
958991796 3:100854596-100854618 TATCATATATTATTACTTAGAGG + Intronic
959854015 3:111126790-111126812 TACCATATTGTGTTACTGAGAGG + Intronic
962003222 3:131322251-131322273 TACCACATGTTGTCACTTATAGG + Intronic
965876700 3:173331797-173331819 TCCCATATGATGTTATTAAGAGG - Intergenic
967358429 3:188600782-188600804 TACCATATGGTTCTACATATAGG - Intronic
972722020 4:41709204-41709226 TACCATATAGTGTTATTGTGAGG + Intergenic
974756329 4:66213086-66213108 CAACATATTTTGTTACTTAGTGG + Intergenic
977261530 4:94802595-94802617 TACCATATGGAGTATCTTAGTGG + Intronic
982146110 4:152394772-152394794 TACCACATAGTGTTATTGAGAGG - Intronic
983683513 4:170380282-170380304 TACCACATGTTCTTACTTATAGG - Intergenic
987331023 5:16857837-16857859 TACCATTTGGTGTGGCATAGTGG + Intronic
989403057 5:41029593-41029615 TAGCATATGGTGTAACATAAGGG - Intronic
990113033 5:52351464-52351486 TTCCATATGGTTTTCCATAGAGG + Intergenic
990823924 5:59875872-59875894 TACCACATGTTCTCACTTAGAGG + Intronic
994228421 5:97282849-97282871 TACCACATGTTCTTACTTATAGG - Intergenic
996134304 5:119820017-119820039 TATGAGATGGTGTTGCTTAGGGG + Intergenic
996970028 5:129355648-129355670 TACCATGTGGTGTTAATGATAGG - Intergenic
997789023 5:136739705-136739727 TACCACATGTTCTTACTTACAGG + Intergenic
1000020175 5:157311543-157311565 TACCATTTGGTGTCACCCAGGGG + Intronic
1000554220 5:162704308-162704330 TAATATATGGTGTTAATTTGAGG - Intergenic
1008026985 6:46649360-46649382 TGCCATATTGTGTTCATTAGAGG + Intronic
1009473615 6:64059929-64059951 TTCCATCTGGTATTTCTTAGAGG - Intronic
1010334701 6:74666801-74666823 TGCCAAATGGGGTTACATAGTGG - Intergenic
1013585190 6:111572158-111572180 TACCACATGATGCTACTCAGGGG - Intronic
1016171216 6:141019388-141019410 TTCTATATGGTGTAAGTTAGGGG + Intergenic
1024043157 7:45570436-45570458 TACCACATGTTCTTACTTATAGG + Intergenic
1028972444 7:96874574-96874596 TTCAATTTGGTGTTCCTTAGTGG - Intergenic
1030667128 7:112291487-112291509 TACCACATGTTATTTCTTAGTGG + Intronic
1031795112 7:126163736-126163758 TACCATATGTTCTCACTTATAGG - Intergenic
1044001715 8:86890321-86890343 TACCATATGATCTCACATAGAGG - Intronic
1044413661 8:91912162-91912184 TACCATATGTTCTCACTTATAGG + Intergenic
1048043845 8:130755124-130755146 TACCATATGTTCTCACTTATAGG + Intergenic
1052578372 9:30319964-30319986 TGCCATATTGTGTTACTGCGTGG + Intergenic
1055854597 9:80670427-80670449 TAACATATGGAGTTGCCTAGAGG - Intergenic
1057583163 9:96305611-96305633 TACCATAGGATGTTATTTATAGG + Intergenic
1059339920 9:113591905-113591927 TACTATAGGGTGTTTGTTAGAGG + Intronic
1059387876 9:113979126-113979148 AACCATATGGAATTAATTAGAGG + Intronic
1188380023 X:29479746-29479768 TACCATATGTTCTCACTTATAGG - Intronic
1189058065 X:37720755-37720777 TACCATATATTCTCACTTAGTGG - Intronic
1189252843 X:39614382-39614404 TAACATATGGAGTGAGTTAGCGG + Intergenic
1191637655 X:63394660-63394682 CACCATATGGTTTTCCATAGTGG + Intergenic
1192738758 X:73873738-73873760 TACCATATGGTCTATCCTAGAGG - Intergenic
1193057963 X:77174848-77174870 CACCAGATGGTGGTACCTAGAGG + Intergenic
1193329981 X:80224706-80224728 TACAATTTGGTGTTCCTGAGGGG + Intergenic
1195553621 X:106196391-106196413 TACCATATGATGTTAATCATAGG + Intronic
1195827433 X:109017538-109017560 TACCATATAGAGTTGCTTTGGGG - Intergenic
1196440287 X:115713596-115713618 TACCATATGAGGTTACTAATTGG - Intergenic
1197386116 X:125804489-125804511 TACCACATGTTGTTACTTATAGG + Intergenic
1199000251 X:142628051-142628073 TACCATATATTGTTACCTATAGG - Intergenic
1199113469 X:143961044-143961066 TAGCATATGGTGTTAGGAAGAGG + Intergenic
1201367405 Y:13223079-13223101 TGCCATATGGTTTTCCATAGAGG - Intergenic