ID: 1146775651

View in Genome Browser
Species Human (GRCh38)
Location 17:35612717-35612739
Sequence TCTGGGACTCAGAACTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146775651_1146775657 4 Left 1146775651 17:35612717-35612739 CCAACCTAGTTCTGAGTCCCAGA 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1146775657 17:35612744-35612766 ATTGCTGGTTACTACCTTCATGG 0: 1
1: 0
2: 0
3: 13
4: 118
1146775651_1146775659 29 Left 1146775651 17:35612717-35612739 CCAACCTAGTTCTGAGTCCCAGA 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1146775659 17:35612769-35612791 GAATGTATACCAGAGAATTTAGG 0: 1
1: 0
2: 0
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146775651 Original CRISPR TCTGGGACTCAGAACTAGGT TGG (reversed) Intronic
900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG + Intronic
902530240 1:17086213-17086235 TCTGGGCCTTAGACCTAGGCAGG + Intronic
902681199 1:18045108-18045130 TTTGGGTGTCAGAACTTGGTAGG - Intergenic
904092092 1:27952420-27952442 TCTTGGACTCAGAACAGGGCTGG - Intronic
904501232 1:30913903-30913925 TCTGGGACTCCAAGCTGGGTAGG + Intergenic
905250249 1:36643790-36643812 TCTGGGACTCAGGAGTAGATAGG - Intergenic
906319961 1:44809637-44809659 TCTGGGCCTCTGAACAAGGCAGG - Intronic
907737743 1:57131472-57131494 TCTGGGACTCAGAAGTATCTGGG - Intronic
908984652 1:70002762-70002784 TGTGGCACTTAGAACTAGATAGG + Intronic
910876488 1:91883636-91883658 GCTGGGATTCAAAACTATGTTGG + Intronic
911412263 1:97524554-97524576 TCTTGGCCTCAGAACTTTGTGGG - Intronic
914980455 1:152410372-152410394 TCTGGAACTCAGACCCAGGCAGG - Exonic
916116966 1:161493602-161493624 TCTGGGAGTCAGCAGAAGGTAGG + Intergenic
916472971 1:165141735-165141757 CCTGGGACTCTGAATTAAGTGGG + Intergenic
917495641 1:175537844-175537866 TCTGGGACTGTGAACTGGTTGGG + Intronic
922326445 1:224532560-224532582 TCTGGGCCTGAGATCTAGCTTGG + Intronic
922675133 1:227544954-227544976 TCTGGGTCTCAGGCCTTGGTGGG + Intergenic
1063096912 10:2916226-2916248 TCTTGGACTTAGGTCTAGGTGGG - Intergenic
1065648139 10:27858285-27858307 TCTGGGGCTCAGAACAGAGTAGG + Intronic
1069470449 10:68684136-68684158 TCTTGGCCTCCGAAGTAGGTGGG - Intronic
1070751639 10:78967429-78967451 TCTGGAACTCAGAACCAAGGAGG + Intergenic
1071856412 10:89629543-89629565 TCTGGGATTCAGAATTAAGATGG - Intronic
1071925029 10:90396528-90396550 TCTGAGACTCAGGACCACGTGGG + Intergenic
1071991158 10:91101980-91102002 TCTGGGGCTCACCACTGGGTAGG + Intergenic
1072043429 10:91631331-91631353 CCTGGGACTCAGAACTACTGAGG + Intronic
1073509339 10:104033683-104033705 TCTGGGACCCAGAACGAGCTAGG + Intronic
1075420044 10:122293980-122294002 TCTGGCATTCAAAACAAGGTGGG - Intronic
1076569510 10:131423196-131423218 TGTCGGTCTCAGAACTAGTTCGG - Intergenic
1077472573 11:2770898-2770920 TTTGGGACTCAGATCTGGGCAGG + Intronic
1084906918 11:72355631-72355653 ACTGGGATTCAAACCTAGGTTGG + Intronic
1085525936 11:77163962-77163984 ACTGAGGCTCAGAACAAGGTGGG + Intronic
1088768162 11:113005478-113005500 TCTGGGACTGAGTACAAGGAAGG + Intronic
1088867386 11:113861647-113861669 CCTGGGAAATAGAACTAGGTCGG - Intronic
1091727677 12:2857030-2857052 TCTGGGCCTCAGAGCCAGGAGGG + Intronic
1097488481 12:60235202-60235224 TCTGGGACAGAGCACTTGGTGGG + Intergenic
1103366564 12:120388650-120388672 GTTGGGACTCAGAACTTGGAGGG - Intergenic
1113881161 13:113627395-113627417 TCTGGGACACAGGCCTGGGTGGG - Intronic
1116033942 14:39605595-39605617 TCTTGGACTCAAAACCAGGTTGG + Intergenic
1116624892 14:47251900-47251922 TATTTGACTCAGAACAAGGTTGG + Intronic
1117831989 14:59760970-59760992 CAAGGGACTCAGAACTAGGAGGG - Intronic
1117903772 14:60563499-60563521 TTTGAGAGTCAGAAGTAGGTTGG - Intergenic
1119704891 14:76777284-76777306 TGGGGGACCCAGAGCTAGGTGGG - Intronic
1124903486 15:33846227-33846249 TCTGGGCCTAAGACCTAGGAAGG - Intronic
1129846375 15:78769475-78769497 TCTGGGACACAGTACTGGCTCGG + Intronic
1130635301 15:85613330-85613352 TATGGGACTCAGAATTCAGTTGG + Intronic
1131046230 15:89317965-89317987 TCTGCCACTCAGAACCAGTTTGG - Intronic
1137365410 16:47855594-47855616 TCTGGGACCCAGAATCAGCTGGG + Intergenic
1139667287 16:68466441-68466463 TCAGTGACTCAGAGCAAGGTGGG + Intergenic
1144371084 17:14592273-14592295 TCTGGGAAGCAAACCTAGGTAGG + Intergenic
1145005715 17:19336613-19336635 TCTGGGACTGAGAAACAGCTGGG - Exonic
1146529889 17:33599495-33599517 TCTGGGGCTCAGAACTACCGGGG + Intronic
1146775651 17:35612717-35612739 TCTGGGACTCAGAACTAGGTTGG - Intronic
1148228019 17:45912812-45912834 TTTGGGCCTGGGAACTAGGTTGG - Intronic
1151439640 17:74119909-74119931 TATGAGACTCAGAGCTTGGTGGG - Intergenic
1151681272 17:75624104-75624126 TCTAGGACTGGGAACTTGGTGGG + Intergenic
1152823056 17:82446872-82446894 TCTGGGGGTCAGAGCTGGGTGGG - Intronic
1155354712 18:24941134-24941156 TCTGGGAACCAGAAATAGGAGGG - Intergenic
1157512731 18:48290307-48290329 ACTGGGACTGAGAAGGAGGTGGG - Intronic
1157608638 18:48941992-48942014 GCTGGGAATCAGAACTTGGGAGG + Intronic
1158588207 18:58758829-58758851 TCTGGAACTCTGAGCTTGGTGGG - Intergenic
1159596868 18:70390830-70390852 TGAGTGACTCAGAACTAGTTGGG - Intergenic
1159613150 18:70548622-70548644 TCTGAGACCCAGATCCAGGTGGG + Intergenic
1162699504 19:12503141-12503163 TCTGGGATTCAGAAATAGAACGG - Intronic
1163029329 19:14533833-14533855 TCTTGGGGTCAGAGCTAGGTCGG + Intronic
1166141524 19:40807856-40807878 TCTGGGACTGGCCACTAGGTGGG - Exonic
1166422836 19:42652083-42652105 TCTGCGACTGAGCACTGGGTGGG - Intronic
1168584463 19:57581946-57581968 ACTGGGCCTCAGGAGTAGGTGGG + Intronic
925633420 2:5917876-5917898 TCTGTGACACTGAACTAGGAGGG - Intergenic
928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG + Intronic
932295007 2:70616828-70616850 TCTGGGCCACAGGACTTGGTGGG - Intronic
937039705 2:118811364-118811386 TCTGGGAAGGAGAACTGGGTGGG - Intergenic
937353658 2:121184793-121184815 TCCAGGACTCAGACTTAGGTGGG - Intergenic
941116182 2:161474967-161474989 CCTGGGCCTCTGAAGTAGGTGGG - Intronic
941268315 2:163392065-163392087 TCTGGGACTCAGACCTCCGGAGG + Intergenic
942113075 2:172701182-172701204 TCTGGGAAGCAGAATTTGGTGGG - Intergenic
942215766 2:173717797-173717819 TCTTGGACTCAGAAGTAAGAGGG - Intergenic
944280522 2:197891377-197891399 TCTGGGAGACAGAACTGGGATGG - Intronic
947349348 2:229226245-229226267 ACTGGGCCACAGATCTAGGTGGG - Intronic
947409633 2:229822712-229822734 TATGGGACTGAGAATTAAGTGGG + Intronic
1170279444 20:14628962-14628984 TCTGGTACTCAGAACTAAATGGG - Intronic
1171313130 20:24162020-24162042 TCCGTGGCTCAGAAGTAGGTTGG - Intergenic
1171425004 20:25043556-25043578 CCTGGGACTCTGAGGTAGGTGGG + Intronic
1172118941 20:32586314-32586336 TCTGGGCCTCAGGACTTGGATGG - Intronic
1172630081 20:36372307-36372329 ACTGGGAGTCAGACCCAGGTAGG + Intronic
1175277222 20:57780471-57780493 TCTGGGACTCAGGTCCAGGCAGG + Intergenic
1177034342 21:16023242-16023264 TCCGGGACTTAGAACAAGGAAGG - Intergenic
1178688431 21:34730355-34730377 TCTGGTCCTCAGGACAAGGTGGG - Intergenic
1178724025 21:35035440-35035462 TCTAGGAGGCAGAACTCGGTTGG - Intronic
1178746318 21:35253859-35253881 TTTGGGACTAAGAACAAGTTTGG + Intronic
1178811897 21:35891850-35891872 TCTGGGACTCAGAAATGGAATGG + Intronic
1179076126 21:38123501-38123523 TCTGGGGTTCAGAACATGGTGGG - Intronic
1181942112 22:26486046-26486068 TCTGGAGTTCAGCACTAGGTGGG + Exonic
1182263779 22:29095961-29095983 TCTGGGACTTGGGACTTGGTGGG - Intronic
1182447164 22:30396726-30396748 TCTGGGCCTCTGAACAAGGAGGG - Intronic
1183363432 22:37394742-37394764 CCTGGGACTGAGCACTGGGTTGG + Intronic
950029941 3:9845735-9845757 TCTGGGAGGCCGAAGTAGGTGGG - Intronic
950568142 3:13783598-13783620 TCTGGGACTCAGGAAAAGGCAGG + Intergenic
952120179 3:30232754-30232776 TGTGTAACTCAGTACTAGGTGGG + Intergenic
953938600 3:47069601-47069623 TCTGGGAGAAAAAACTAGGTAGG + Intronic
954672847 3:52299793-52299815 CCTGTGACTGAGAACTGGGTAGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956650345 3:71499079-71499101 TCTAGGACACAGAGCTGGGTGGG - Intronic
956705635 3:71996542-71996564 TCTGGGATTCAGAAGCAGGGAGG - Intergenic
959702401 3:109310480-109310502 CCTGGGACTCAAACCTATGTAGG + Intronic
961673658 3:128551869-128551891 TCTGGGACACAGAAGGAGGTGGG - Intergenic
963210868 3:142688351-142688373 TCTGGTGCACAGAATTAGGTAGG + Intronic
963790058 3:149574413-149574435 TTTGGGCCTCACAACCAGGTGGG + Intronic
965039688 3:163490458-163490480 TCTGGGTATCAGCACTTGGTGGG + Intergenic
967790523 3:193543941-193543963 TCTGAGACTCAGAAAGAGGCTGG + Intronic
967867246 3:194200290-194200312 TCTGGGATTCATAACTAATTTGG - Intergenic
967954288 3:194865801-194865823 ACTGAGACTCAGAAGTAGGAAGG + Intergenic
970285273 4:14506274-14506296 TCTGGGACTCAGAAGTGGAAGGG + Intergenic
971314033 4:25552356-25552378 TTTGGGAGTCAGAAGTAGGCAGG + Intergenic
976575004 4:86658669-86658691 TCTGGAACTCAGAGGTATGTTGG - Intronic
977750605 4:100605497-100605519 TCCTGAATTCAGAACTAGGTTGG + Intronic
977753374 4:100635604-100635626 TCTGGGACTCAAAACTCACTTGG - Intronic
979229066 4:118325585-118325607 CCTGGTACTCAGAACTATGCTGG + Intronic
980207290 4:129736350-129736372 TATAGCATTCAGAACTAGGTAGG + Intergenic
980491758 4:133536748-133536770 ACTGGGACTCAAAACTTGGAGGG - Intergenic
986422849 5:7601427-7601449 TCTGGCACTAAGATTTAGGTAGG + Intronic
987399708 5:17463025-17463047 TCAGGGGCACAGAACTAGATAGG - Intergenic
990068094 5:51743666-51743688 TCTAGGACTCATAACTAGAAAGG - Intergenic
993692242 5:91016349-91016371 GCAGGGACTGAGAACTAGGATGG - Intronic
997231419 5:132246398-132246420 TCTGGGTCTAAGAACTAAGTGGG + Intronic
999030873 5:148289825-148289847 TCTGGGAATCAGAATTAGGATGG + Intergenic
999722252 5:154407223-154407245 ACTGGGACTCGGAAGTAGGAAGG + Intronic
1000360837 5:160445797-160445819 TCTGGGACTGAGAAATAAGTTGG + Intergenic
1002785641 6:397714-397736 TCTGGGACCCAGTGGTAGGTAGG - Intronic
1004265536 6:14145541-14145563 TCTGGTCCTCAGGACTGGGTAGG + Intergenic
1012243165 6:96897441-96897463 TCTGGGTCTCGGAAGTAGGCGGG + Intronic
1013747221 6:113359752-113359774 TCTGGGACACAGACCCAGGAGGG - Intergenic
1014036600 6:116773869-116773891 TCTAGGGCTCAGTACTAGGAAGG - Intergenic
1016601203 6:145862887-145862909 TCTGGATTTTAGAACTAGGTAGG + Intergenic
1019116543 6:169768630-169768652 GCTGGGACTCAGGAGTAGGTGGG - Intronic
1019172357 6:170139801-170139823 TGAGGGAGTCAGAAATAGGTTGG - Intergenic
1019264481 7:105893-105915 TCTGGGACGCACACCTAGGGGGG - Intergenic
1019852812 7:3576338-3576360 TGTGTGACTCTGAGCTAGGTGGG + Intronic
1026688994 7:72536237-72536259 TCAGGGACTCACATCTGGGTTGG + Intergenic
1026724223 7:72858123-72858145 TCAGGGACTCACATCTGGGTTGG + Intergenic
1033585239 7:142770033-142770055 TCTGAGAATCAGCAGTAGGTAGG - Intergenic
1036215470 8:6876551-6876573 TTTGGGAGTCTGAACTAGGAGGG + Intronic
1043506453 8:80907801-80907823 ACTGGGACTCACAACTTGGGGGG + Intergenic
1045541214 8:103087439-103087461 TCTGGGACTCAGAAATGGAATGG - Intergenic
1046717577 8:117584348-117584370 ACAGGGACTCAGAAGCAGGTGGG + Intergenic
1046997787 8:120543584-120543606 TCTGGCACTCAGGACAAGGAGGG + Intronic
1049210921 8:141386083-141386105 TCTGGGTCTCAGGACCTGGTGGG + Intergenic
1049664406 8:143836663-143836685 TCCGGGAATCAGCACCAGGTGGG + Intronic
1051286314 9:15500824-15500846 TCTAAGATACAGAACTAGGTAGG + Intronic
1052916333 9:33926729-33926751 TCTAGGAGTCAAAACAAGGTTGG + Intronic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1060151961 9:121294514-121294536 CCTGGGTCCCAGCACTAGGTGGG + Intronic
1061412878 9:130430683-130430705 TCTGGGTTTCTGAACTCGGTGGG - Intronic
1061955567 9:133959611-133959633 TCTGGGAGTCAGGACAAGATAGG - Intronic
1185910072 X:3973022-3973044 TCTGGAACTCTGAAGTTGGTAGG - Intergenic
1187096888 X:16158127-16158149 CCTCAGACACAGAACTAGGTGGG - Intergenic
1188247467 X:27853513-27853535 GCTGGGGCTCAGCACTAGCTGGG - Intergenic
1190435446 X:50420011-50420033 ACTGAGACTCAGAAAGAGGTAGG - Intronic
1195311225 X:103633647-103633669 TCTGGGACTCTGAGCAAGGTGGG - Intergenic
1195314667 X:103665958-103665980 TCTGGGAGTCTGAGCAAGGTGGG - Intergenic
1198573445 X:137983793-137983815 TCTGGGCCAAAGAAATAGGTAGG - Intergenic
1200895554 Y:8372554-8372576 TCTGGGACTTAGAAGTAAGGGGG - Intergenic