ID: 1146776624

View in Genome Browser
Species Human (GRCh38)
Location 17:35624353-35624375
Sequence GTGCTGTTCTTGGTGAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146776620_1146776624 23 Left 1146776620 17:35624307-35624329 CCGTGAAATGACCCAGAGAAGGC 0: 1
1: 0
2: 1
3: 12
4: 227
Right 1146776624 17:35624353-35624375 GTGCTGTTCTTGGTGAATCAAGG 0: 1
1: 0
2: 0
3: 9
4: 155
1146776621_1146776624 12 Left 1146776621 17:35624318-35624340 CCCAGAGAAGGCTGATGAAGTGT 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1146776624 17:35624353-35624375 GTGCTGTTCTTGGTGAATCAAGG 0: 1
1: 0
2: 0
3: 9
4: 155
1146776622_1146776624 11 Left 1146776622 17:35624319-35624341 CCAGAGAAGGCTGATGAAGTGTT 0: 1
1: 0
2: 1
3: 18
4: 154
Right 1146776624 17:35624353-35624375 GTGCTGTTCTTGGTGAATCAAGG 0: 1
1: 0
2: 0
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146776624 Original CRISPR GTGCTGTTCTTGGTGAATCA AGG Intronic
901747027 1:11380670-11380692 GTGCTGTTCTCTGTAAACCAAGG + Intergenic
902614171 1:17614824-17614846 GTGCTGTGCATGGGGAAGCAGGG - Intronic
903772832 1:25774780-25774802 GTGCTGTTCCTTGTGGAGCAGGG - Intronic
907743134 1:57186232-57186254 GGGCTGTTTTTGGAGAAACACGG - Intronic
908412862 1:63884282-63884304 CTGCTGTTCCTGGTGACTCTTGG + Intronic
911545470 1:99211042-99211064 CTGGAGTTGTTGGTGAATCATGG + Intergenic
913283059 1:117203751-117203773 GTGCTTTTCTGGAGGAATCAGGG + Intronic
914693271 1:150050759-150050781 AGCCTGTTCTTGGTGATTCAAGG + Intergenic
917490763 1:175496436-175496458 GTACTCTTCTTGGTGACTCGGGG + Intronic
919439756 1:197617107-197617129 TTGCTTTTCATGGTGGATCAAGG + Intronic
919508137 1:198426151-198426173 CTGTTGTTCTTGGTGACTCCTGG + Intergenic
919690613 1:200525311-200525333 ATGCTGTTCTTGGTGAGGCCTGG - Intergenic
920366186 1:205449555-205449577 GTGCTGTTGTTGGGGAATGCAGG - Intronic
920581563 1:207113156-207113178 CTGCTGTTCTTGGTGAGTAGTGG + Exonic
923541309 1:234890182-234890204 GTGCTGTTCCTGGGAAAGCATGG + Intergenic
1063078929 10:2746428-2746450 GTGATGTTCTTAGTGCTTCATGG + Intergenic
1068614029 10:59091884-59091906 GTGCTGTTATTGTTGGAGCAAGG + Intergenic
1072443154 10:95475147-95475169 CTGATGTTCTTTGTGAATGATGG - Intronic
1072950561 10:99843458-99843480 CTAGTGTTCTTTGTGAATCAGGG - Intronic
1074992560 10:118723043-118723065 GTACTGTTCCTTGTGGATCAGGG - Intronic
1075833650 10:125433624-125433646 GGGTTGTTCTTGCTGACTCAGGG - Intergenic
1077199992 11:1301964-1301986 GTGCTGTTCTATGTGAGTCCTGG - Intronic
1077463415 11:2722153-2722175 GTCCTGAGCTTGGTGAGTCAGGG + Intronic
1077734352 11:4773290-4773312 GATCTGTCTTTGGTGAATCAAGG + Intronic
1079145333 11:17846200-17846222 GTGCTGTGCATAATGAATCACGG + Intronic
1079312679 11:19380372-19380394 GTGCTGGTCTGGGAAAATCATGG + Intronic
1081767769 11:45623783-45623805 GTGCTGGTCTTGCTGTCTCAGGG + Intergenic
1085058309 11:73421336-73421358 GTGCTGTTTTTGTTGAACCAAGG + Intronic
1087618153 11:100512270-100512292 GTGCTGTTATGTGTGAATGATGG + Intergenic
1088015410 11:105052582-105052604 GTGCTGTTATTCGAGAATTATGG + Intronic
1088361174 11:108991749-108991771 GTGGTTTTCTTGGTGAATTCAGG + Intergenic
1088505767 11:110525548-110525570 GTGCTGCTCTAGGTGAAGTAGGG + Intergenic
1091250839 11:134142443-134142465 GTGCTGTTTTTAGTGTATTATGG + Intronic
1094238324 12:28193191-28193213 GTGCTGTTCTTTGTACATTAAGG + Intronic
1097670985 12:62537660-62537682 GGGCTGTTCTTGGAACATCATGG + Exonic
1102455062 12:113065906-113065928 GTGATGTTCTTGGTGCATGGGGG + Intronic
1109853987 13:68105150-68105172 AGGCTGTTCTTACTGAATCAAGG + Intergenic
1110291366 13:73810829-73810851 GTGCTGACCGTGGTGAGTCAGGG + Intronic
1112855030 13:103757917-103757939 GGGCTGATCTTGGTGTCTCAGGG - Intergenic
1113886030 13:113658738-113658760 TTGCTGCTCTGGGTGAATCTGGG - Intergenic
1116427669 14:44810099-44810121 GTGCTGTGCTTGTTGCTTCATGG - Intergenic
1116688519 14:48074310-48074332 GTGCTGTTCTTGCAGAGTGATGG - Intergenic
1119688559 14:76652765-76652787 GTGCTGTTCATTGTGAACTATGG - Intergenic
1119765094 14:77182805-77182827 GTGCTGTTCTTGTGGGTTCAAGG + Intronic
1131364023 15:91822250-91822272 GTGCTGTGTTTGGAGAATCCAGG - Intergenic
1132509868 16:334165-334187 GTGCTGTTATTGGTGTGCCATGG - Intronic
1133076780 16:3285973-3285995 GAATTGTTCTTGGTGCATCAGGG + Intronic
1137536504 16:49330926-49330948 GTGCTGTTCATGGGCAGTCAGGG + Intergenic
1139717710 16:68826835-68826857 GTGTTCTTGTTGATGAATCATGG + Intronic
1140957264 16:79877173-79877195 ATGGTGATCTTGGTGGATCATGG + Intergenic
1141737822 16:85866631-85866653 GTGTTGTTCTTGCTGTCTCAAGG - Intergenic
1143615149 17:8045244-8045266 TCCCTGTTCTTGGTGGATCACGG + Exonic
1144166808 17:12619970-12619992 CAGCTGTTCCTGGTGAATCCTGG + Intergenic
1146717797 17:35100927-35100949 GTGCTGTTGTTTGGGAAACAGGG - Exonic
1146776624 17:35624353-35624375 GTGCTGTTCTTGGTGAATCAAGG + Intronic
1147038374 17:37698859-37698881 GTGCTCTTCCTGGGGAATCTGGG + Intronic
1147791987 17:43019792-43019814 GTGCTGTTCTGGGACAATCTGGG + Intronic
1148215862 17:45833766-45833788 ATGCTGTTCTTCGTCAATCCCGG + Exonic
1149028703 17:52060181-52060203 ATGCTTTTCTTGGTTAATCTGGG - Intronic
1152031221 17:77844751-77844773 TTGTTGTTTTTGGTAAATCAAGG - Intergenic
1157172973 18:45425017-45425039 GGGATGTGCTTGGTGAAACATGG - Intronic
1160335201 18:78032683-78032705 GTGCTTTGCTTTGGGAATCAGGG - Intergenic
1166409440 19:42546908-42546930 CTGCTGTTCTTGGTCCATGAAGG - Intronic
1168245816 19:55112746-55112768 GTGCGCTTCTTGGTGGAGCAGGG - Exonic
1168363347 19:55762198-55762220 CTGCTGTTGTTTGTGAAGCATGG - Intronic
1168364302 19:55772202-55772224 CTGCTGTTGTTTGTGAAGCATGG - Intronic
1168379324 19:55906853-55906875 ATGCTGCTCTTGCTGGATCATGG - Intronic
925517007 2:4693715-4693737 CTGCTGGTCTTGGGGAATTAGGG + Intergenic
925600049 2:5598903-5598925 CTGCTTTTGTTGGTGAAACAAGG + Intergenic
927850978 2:26499121-26499143 GAGATGTTCTTGGTGGATCAAGG - Intronic
930214331 2:48678830-48678852 GTGCTGTTCTTGAACAATCCAGG + Intronic
930336390 2:50052771-50052793 GTGGCTTTCTTGGTGAATGATGG - Intronic
930414235 2:51069560-51069582 GGCCTGTTCTTGGTGGACCAAGG - Intergenic
933278356 2:80305456-80305478 GTGCTGTTCATGGTGATTACTGG + Intronic
937350864 2:121160288-121160310 GTGCAGTTCTTAGCTAATCATGG + Intergenic
942910919 2:181243450-181243472 GTACTGTTCTTTGAGAATGAAGG + Intergenic
946572420 2:221039640-221039662 GTGCTGATGATGGGGAATCATGG - Intergenic
948705142 2:239786350-239786372 GGGCTGTTCTCAGTCAATCATGG - Intronic
1169057544 20:2635844-2635866 GCGCCTTTCTTGGGGAATCAGGG - Intronic
1171433083 20:25098642-25098664 GTGCTTTTCTGGAGGAATCAGGG - Intergenic
1172745247 20:37202563-37202585 GTGCTTTTCTGGGTGAAACTGGG - Intronic
1172852835 20:37978924-37978946 TTGCTGTTGTTGTTGAAACAGGG - Intergenic
1173881408 20:46415498-46415520 GTGATGCTTTTGGTGAATGAAGG + Intronic
1182186281 22:28405945-28405967 GTACTGTTCTTTGTGGAGCAGGG - Intronic
1184069902 22:42141230-42141252 GTGCTGCACCTCGTGAATCACGG + Intergenic
1184810585 22:46828878-46828900 GTGCTGTTCTTAGTACCTCATGG + Intronic
952282566 3:31937888-31937910 CTGCTGGACTTGGTGACTCAGGG - Intronic
952759611 3:36902503-36902525 TTACTGTTCTTGGTGCCTCAAGG - Intronic
953217198 3:40930664-40930686 GTATTGTTCTTGGTTATTCAGGG - Intergenic
956416160 3:69032266-69032288 GTGCTATTCCTTGTGAATCGGGG - Intronic
963447923 3:145439246-145439268 GTGGTGGTGTTGGTGATTCAGGG - Intergenic
963622956 3:147635090-147635112 GTGCTGTTGTTGGAGCATGATGG + Intergenic
964117273 3:153149320-153149342 GTGCTGTTCGTGAGGAATTAAGG - Intergenic
964738497 3:159941283-159941305 GTGATGTGCTTGGTGGCTCATGG - Intergenic
966284109 3:178272942-178272964 GTGCTGTTTTGAGTGAAACAGGG + Intergenic
967065747 3:185913727-185913749 GTGCTGGTCTTGCTGCCTCAGGG + Intergenic
968900296 4:3427947-3427969 GGGCTGTGCGTGGTGAATAAGGG + Intronic
971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG + Intergenic
972172217 4:36360197-36360219 GTGTTGTTCTAGGTGAAATATGG - Intergenic
973019427 4:45183458-45183480 GTGTTGTTCTTGCTGTCTCAGGG + Intergenic
975188606 4:71433110-71433132 GTGGTTTTCTTGGAGAATGAAGG - Intronic
975843387 4:78500259-78500281 GTGCTGTGCTGGGTCAGTCAAGG + Intronic
976131419 4:81888494-81888516 GTCCTCTACTTGGTGATTCATGG - Intronic
978218616 4:106240407-106240429 GTGGTTTTCTTTGTGAATTAAGG - Intronic
979585361 4:122409014-122409036 GTGCTGTCCTTGGACAATTATGG - Intronic
983154156 4:164324974-164324996 GTGCTATTCTTGGTTATTCTTGG - Intronic
983279117 4:165658445-165658467 GTGCTGCTCTTGCTGTCTCAGGG + Intergenic
983298977 4:165901767-165901789 GTGCTGTTCTGGGAGATCCATGG + Intronic
984667737 4:182447486-182447508 TTACTGTTGTTGTTGAATCATGG + Intronic
1202751677 4_GL000008v2_random:11247-11269 GTGCTGAAATTGGTAAATCATGG + Intergenic
986597729 5:9441090-9441112 GTGCTGTGCATGGTGATTAACGG - Intronic
988677054 5:33442964-33442986 GTGCTGTTCTGAGTGAGTCAGGG + Intronic
989401941 5:41017176-41017198 GGGCTGTCCTTGGTGAAACATGG + Intronic
991334987 5:65537057-65537079 GTGCTGTTTTTGGTGAGGGAAGG - Intronic
992585538 5:78235302-78235324 TGGCTGTACTTGGTGAATAAAGG - Intronic
993440689 5:87953455-87953477 GTGATATTCTTGGTGCATCTAGG + Intergenic
997767613 5:136520702-136520724 GTGTTGTTCTTGCTGTATCAGGG - Intergenic
998416721 5:141951556-141951578 CTGCTGTCCTTGCTGCATCAGGG - Exonic
999204805 5:149840362-149840384 GTGCTGTTGGTGGTGATTTAGGG + Intronic
1000728884 5:164805958-164805980 GTACTGCTCTTTGTGAACCAGGG + Intergenic
1000744476 5:165016087-165016109 GTTCTGTTCTTATTGAAACAAGG + Intergenic
1001872187 5:175166408-175166430 GTTTTGTTGTTGGTGAATCCTGG + Intergenic
1004249621 6:14012810-14012832 GTGGTGTTGTTGGGAAATCAGGG - Intergenic
1005393450 6:25356882-25356904 GTGCAGTTTTTAGTGAATGATGG + Intronic
1005938475 6:30543110-30543132 AAGCTGGTCTTGGTGAATCAGGG - Exonic
1006034219 6:31198997-31199019 GTGCAGTTGTGGGTTAATCATGG - Intronic
1006785124 6:36661313-36661335 GTGCTGTGTTTGGTGTGTCAAGG - Intergenic
1006886290 6:37384853-37384875 GTCCTGTCCCTGGAGAATCAGGG + Intronic
1007116136 6:39344659-39344681 GTGCTGGTTTGGGTAAATCAGGG - Intronic
1010939152 6:81895610-81895632 ATTCTGTTATTAGTGAATCAGGG + Intergenic
1011471110 6:87708744-87708766 GTGCTTTTCTTGATGATTCATGG - Intergenic
1011696332 6:89917223-89917245 GTGATTTTCTTGGTGGCTCATGG + Intergenic
1012963795 6:105650949-105650971 ATGCTATTCTTGCTGATTCAAGG - Intergenic
1013301484 6:108808749-108808771 GTGGTGGTCTTGGTGCCTCAGGG + Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1014468952 6:121791310-121791332 TTGATGTTCTTGGTGAAGGAAGG - Intergenic
1017460077 6:154641024-154641046 GTGTTGCTCTGGGTGAGTCAGGG - Intergenic
1022468592 7:30667688-30667710 GTGCTGATATTGGTGAAGTATGG - Intronic
1022663221 7:32385934-32385956 GTCCTGTTCTTGGGGTTTCAAGG - Intergenic
1022792897 7:33706306-33706328 GAGCAGGTCTTGGGGAATCAAGG - Intergenic
1024252226 7:47514852-47514874 GTGCTGTTATGGGTGAGTCTCGG - Intronic
1026026456 7:66748451-66748473 TTTCTGTTGTTGGTGAATCACGG + Intronic
1026329369 7:69338434-69338456 GTGTTGTTCTTGGGGAGACAGGG + Intergenic
1026387925 7:69869605-69869627 GTGGTATTCTTGGGGAATCTTGG + Intronic
1031310199 7:120186924-120186946 GTGCAGTTCATGGTAACTCATGG - Intergenic
1033148014 7:138887712-138887734 ATGCTGGTCTTGGTCAATCAAGG + Intronic
1036675140 8:10825299-10825321 GTGCTGTTCCTGGCATATCAAGG + Intronic
1038709879 8:29933688-29933710 GTTCTGCTTTTGGTTAATCAAGG - Intergenic
1038932680 8:32212659-32212681 GTGTTCTTCTTGATGACTCAAGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1048357262 8:133663805-133663827 ATGTTGTTCTGGTTGAATCATGG + Intergenic
1049671425 8:143871794-143871816 GTGCTGTACTTGATGAATGGGGG + Exonic
1051332419 9:16036300-16036322 GGGCTGTTCTTGGGCCATCATGG - Intronic
1052365502 9:27607872-27607894 GTGTTGTTATTTTTGAATCATGG - Intergenic
1060972145 9:127744469-127744491 CTGCTGTACTTGGGGAATCTGGG + Intronic
1187954274 X:24500658-24500680 CTGATGTTCTTGGTGAAGGAAGG + Intronic
1195693105 X:107645215-107645237 CTTCCGTTCTTTGTGAATCAAGG - Exonic
1196201041 X:112886275-112886297 ATGCTGTTTTTGCTGACTCAAGG - Intergenic
1196863927 X:120053132-120053154 GAGCTGTTCCTTGTGAAGCAGGG - Intergenic
1196879172 X:120183198-120183220 GAGCTGTTCCTTGTGAAGCAGGG + Intergenic
1198777192 X:140192423-140192445 CTTCTGTTCTTGGTAAATGATGG - Intergenic
1199651525 X:149949490-149949512 GTGCTGTACATTGTGAATCTTGG - Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic
1200366088 X:155666141-155666163 GGGCTGTTCAAGGAGAATCAAGG + Intronic
1201986726 Y:19976782-19976804 GTGCTTTTCTTAATGAATTAGGG - Intergenic