ID: 1146780657

View in Genome Browser
Species Human (GRCh38)
Location 17:35668674-35668696
Sequence GGCCAGTTAGACTGGAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146780657_1146780662 29 Left 1146780657 17:35668674-35668696 CCTGTGTTCCAGTCTAACTGGCC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 1146780662 17:35668726-35668748 TGTTCATGCTATTTGAGAAATGG 0: 1
1: 0
2: 0
3: 29
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146780657 Original CRISPR GGCCAGTTAGACTGGAACAC AGG (reversed) Intronic