ID: 1146780657

View in Genome Browser
Species Human (GRCh38)
Location 17:35668674-35668696
Sequence GGCCAGTTAGACTGGAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146780657_1146780662 29 Left 1146780657 17:35668674-35668696 CCTGTGTTCCAGTCTAACTGGCC 0: 1
1: 0
2: 0
3: 14
4: 114
Right 1146780662 17:35668726-35668748 TGTTCATGCTATTTGAGAAATGG 0: 1
1: 0
2: 0
3: 29
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146780657 Original CRISPR GGCCAGTTAGACTGGAACAC AGG (reversed) Intronic
900186213 1:1334420-1334442 GGCCAGAATGACGGGAACACAGG + Exonic
901877013 1:12172603-12172625 AGCCACTTAGACAGGAACTCTGG - Intronic
903368487 1:22819313-22819335 TGCCAGAGAGACTGGAACAGAGG - Intronic
904402050 1:30263436-30263458 GGCCACTCAGCCTGGAACATGGG - Intergenic
909110606 1:71471968-71471990 GCCCAGAAAGTCTGGAACACAGG - Intronic
914394583 1:147252846-147252868 AGCCAGTTAGCCTGGATCCCAGG - Intronic
915276522 1:154792577-154792599 GACCAGTTAAACTGGAATAAGGG - Intronic
916442253 1:164839047-164839069 GGCCAGAAAGAATGGAACAGGGG - Intronic
916511324 1:165474585-165474607 GGCCAGTGTGGCTGGAACAGAGG + Intergenic
918396190 1:184115496-184115518 GGTCAGTGTGGCTGGAACACAGG + Intergenic
921337216 1:214100335-214100357 GGCCAGTTAAACTGGAGCCAAGG + Intergenic
922188869 1:223299573-223299595 TGCCAGTTTGACTGGGCCACAGG + Intronic
924704721 1:246491151-246491173 GACCAGTCAGACTAAAACACAGG + Intronic
1062965857 10:1607337-1607359 GGCCATTTAGGCTGGGACAGAGG + Intronic
1063250906 10:4273661-4273683 TGTCAGTTTGACTGGGACACAGG + Intergenic
1063643112 10:7851354-7851376 GGTCAGTGTGACTGGAACAGGGG + Intronic
1064041753 10:11972175-11972197 GGCCAGCTTGACTAGAACAGAGG - Intronic
1066165298 10:32781802-32781824 GACCAGTTAGAATAGAAGACAGG + Intronic
1067184680 10:44016442-44016464 GGCCAGTTTCACTGGAGCAAAGG + Intergenic
1073739740 10:106392995-106393017 GGCCAGTCACAGTGTAACACAGG + Intergenic
1074280700 10:112048879-112048901 GGACAGTGAGTCAGGAACACAGG - Intergenic
1078072985 11:8130601-8130623 GGCCAGTGAGAGTGGAAAAGTGG - Intronic
1078073156 11:8132240-8132262 GGCCAGTGAGAGTGGAAAAGTGG - Intronic
1078481114 11:11676493-11676515 GGCTAGTGTGACTGGAACACGGG - Intergenic
1080826771 11:35855157-35855179 GCCCAGAGAGCCTGGAACACAGG - Intergenic
1084469778 11:69352394-69352416 GGCCAGCTAGGCTGGGCCACAGG - Intronic
1086090178 11:82997462-82997484 TGCCAGCTAGACAGAAACACAGG + Intronic
1092795631 12:12107871-12107893 GGCCAGAAAGGCTGTAACACTGG - Intronic
1093381261 12:18496719-18496741 GGCCAAATAAACTGGAAGACGGG - Intronic
1094686931 12:32726759-32726781 GGCCAGATAGATTGGAAAAAAGG - Intronic
1097002788 12:55892141-55892163 GACCAGTTAGTGTGGACCACTGG + Intergenic
1098466980 12:70798567-70798589 GGCCAGTGTGGCTGGAGCACTGG - Intronic
1098491240 12:71081718-71081740 GGCCTGTGAGACTGGGACCCCGG - Intronic
1098875083 12:75858617-75858639 GCCCAGTTTGTCTGGGACACTGG - Intergenic
1099220844 12:79912026-79912048 GGCCAGTGTGACTGGAGCACAGG - Intronic
1101714321 12:107297330-107297352 GGCCAGTGTGGCTGGAGCACAGG - Intergenic
1103522503 12:121545849-121545871 GGCCAGTGGGGCTGGAACAGAGG - Intronic
1104282190 12:127388246-127388268 GGCCAGTAAAACAGAAACACAGG + Intergenic
1104322468 12:127764562-127764584 GGCCAGCTTGGCTGGAGCACAGG - Intergenic
1106168455 13:27269559-27269581 GGCAAGTGAGGCTGGAACACAGG + Intergenic
1107036358 13:35906591-35906613 GCCCAGTTAGACATGAACACAGG + Intronic
1108935003 13:55872466-55872488 GGCCAGTTGGACTAAAGCACAGG + Intergenic
1113862570 13:113498770-113498792 GGCCAGATGGATTGGGACACTGG + Intronic
1117782637 14:59250117-59250139 GGCCAGTTAGAAGAGAACATGGG - Intronic
1119415829 14:74468564-74468586 GGCCTGAGAGGCTGGAACACAGG - Intergenic
1120024568 14:79568547-79568569 GGCCTTTTAGACTGGTACCCTGG - Intronic
1121452886 14:94020582-94020604 GGCCAGTCTGGCTGGAGCACAGG - Intergenic
1122947528 14:105019919-105019941 GGCCAGCTAGTCTCGAACTCGGG + Intronic
1128273242 15:66330617-66330639 GGCCAGTGTGACTGAGACACTGG - Intronic
1133653378 16:7834721-7834743 GGAGAGATAGACTAGAACACAGG - Intergenic
1134063283 16:11211587-11211609 GGCCAGTGGGGCTGGAACACTGG - Intergenic
1139143589 16:64297419-64297441 GGCCATCTTGACTGGAATACTGG + Intergenic
1141172602 16:81700759-81700781 GGCCAGGGTGGCTGGAACACAGG + Intronic
1142189746 16:88712439-88712461 GGCCAGTGAGGCTGGGACACGGG - Intronic
1203139697 16_KI270728v1_random:1753560-1753582 GGCCAGTAAGGCAGGAGCACGGG + Intergenic
1146227405 17:31078889-31078911 GGCCAGGTTGGCTGGAATACGGG - Intergenic
1146780657 17:35668674-35668696 GGCCAGTTAGACTGGAACACAGG - Intronic
1151451121 17:74198941-74198963 GGCCAGGCAGACTGGAACAGGGG - Intergenic
1156483268 18:37449304-37449326 GGCCAGTGTGACTGGGACAGCGG + Intronic
1156936157 18:42710324-42710346 TTCCAGTTAGACTGCAACTCAGG - Intergenic
1157359514 18:46964577-46964599 GGCCACTTGGTCTGGAACGCCGG + Intronic
1157361108 18:47024096-47024118 GGCCACTTGGTCTGGAACGCCGG + Intronic
1157362098 18:47030011-47030033 GGCCACTTGGTCTGGAACGCCGG + Exonic
1161243339 19:3235080-3235102 GGCCAGTGTGGCTGGAACAGAGG - Intronic
1163429923 19:17261219-17261241 GGCCAGTGTGGCTGGAACACAGG - Intronic
1165992168 19:39822660-39822682 GGCCAGTGTGGCTGGAGCACAGG + Intergenic
1166084485 19:40465925-40465947 CGCCACTTAGACTGGAAGGCGGG + Intergenic
1166157391 19:40924254-40924276 GGGCAGTCAGACTGGAACCATGG + Intergenic
1167237475 19:48323632-48323654 GGCCAGTGTGGCTGGAGCACAGG - Intronic
1167280015 19:48561641-48561663 GGACAGTGAGAACGGAACACTGG + Intronic
925025178 2:601710-601732 GGCCAGTTTGACTGGGCCACAGG - Intergenic
925662972 2:6222335-6222357 TCCCAGTTAGACTGAAGCACTGG + Intergenic
928875719 2:36036727-36036749 GACCAGTTTGCCTGGAAGACAGG + Intergenic
928958064 2:36892077-36892099 AGCCTGTAAGACTGGGACACAGG - Intronic
932690486 2:73908790-73908812 AGCCAGGAAGACTTGAACACTGG + Intronic
937377078 2:121344674-121344696 GGCCTGTAACACTGGAACACAGG + Intronic
938041958 2:128083380-128083402 CACCAGTGAGACTGGAGCACTGG - Intergenic
938773187 2:134518751-134518773 GGCGAGTTAGACAGGAAAAGAGG - Intronic
941111041 2:161418760-161418782 GGTCAGTTAGCCTGGAAGGCGGG + Intronic
942436515 2:175983396-175983418 TTCTAGTTAGCCTGGAACACAGG + Intronic
947140605 2:227016461-227016483 CCCCAGTTACAGTGGAACACAGG + Intronic
947463637 2:230323448-230323470 GGCCGCTTGGACGGGAACACGGG + Intergenic
1182966203 22:34523487-34523509 GGCCAGTGTGGCTGGAACAACGG - Intergenic
1185200341 22:49498782-49498804 GGCCAATCAGACTGGAACGGAGG + Intronic
951367553 3:21802786-21802808 GCCCAGTTAGACAGGCAGACAGG - Intronic
952828713 3:37545459-37545481 AGACAGTTAGCCTGGAAAACAGG - Intronic
954155096 3:48681017-48681039 GGCCTGCAGGACTGGAACACAGG - Intronic
956072999 3:65474357-65474379 GGACAGGTAGAATGGAATACTGG + Intronic
956247217 3:67197353-67197375 TGCCAGTTAGACAGGGGCACAGG - Intergenic
962088550 3:132218461-132218483 GGCCAGTGAGACTTCATCACAGG + Intronic
963008163 3:140745653-140745675 GGCCAGTGGGCCTGGAGCACTGG + Intergenic
964163075 3:153669424-153669446 GTCCAGTGTGGCTGGAACACAGG + Intergenic
967395012 3:188998400-188998422 GGCCAGTATGGCTGGAACATAGG + Intronic
968041267 3:195591253-195591275 GGTCAGGGAGTCTGGAACACTGG - Intergenic
977229957 4:94440268-94440290 GGTCATTTAGATTTGAACACTGG - Intergenic
985384447 4:189430846-189430868 GGCCACCCAGACTGGTACACTGG + Intergenic
990660791 5:58013137-58013159 GCCCAGTTATTCTGGATCACTGG - Intergenic
993343724 5:86756509-86756531 GGCCATCGAGACTGGAAGACAGG - Intergenic
994183729 5:96796380-96796402 GGCCAGGTACACTGGAATGCTGG - Intronic
998681849 5:144476738-144476760 GTCCAGGTAGCCTGCAACACTGG + Exonic
1000094257 5:157957292-157957314 TGAGAGTTTGACTGGAACACTGG + Intergenic
1000341390 5:160279734-160279756 GGCCAGTGTGGCTGGAACCCAGG + Intronic
1002290141 5:178194781-178194803 GGGCAATAAGGCTGGAACACTGG - Intergenic
1003132220 6:3404628-3404650 GGCCAGTTAGGCAGGGCCACTGG - Intronic
1003463033 6:6350185-6350207 TGCCATTTAGACTTGAAAACTGG - Intergenic
1005467706 6:26131291-26131313 GGCCAATGAGAATGGATCACTGG + Intronic
1009170526 6:60393600-60393622 GGCCAGTTAATCTGTAACAAAGG + Intergenic
1011430555 6:87281872-87281894 GGCCAGTGAGACCAGGACACAGG + Intergenic
1013664971 6:112338504-112338526 GCCCAGTTAGGCTGAACCACTGG + Intergenic
1016428043 6:143955301-143955323 GTTCAGTAAGACTGGAATACAGG + Intronic
1019879470 7:3845574-3845596 GGCCAGCGAGACTGGAAACCAGG + Intronic
1034452193 7:151143023-151143045 GGCCAGATAAGCTGCAACACGGG + Intronic
1037173980 8:15925758-15925780 GGACAGTCAGACTTGAATACTGG + Intergenic
1047559002 8:125966103-125966125 GTCCAGTTTGTCTGGAGCACAGG - Intergenic
1047577821 8:126177484-126177506 GGCTAGGTAGACTAGAACAGAGG + Intergenic
1047744918 8:127837628-127837650 GACCATTTAGCCTGGCACACAGG - Intergenic
1048584250 8:135757858-135757880 AGCCAGTAAGACTGGACCTCTGG - Intergenic
1048593565 8:135843784-135843806 GGAAAGTTAGCCTGGACCACGGG - Intergenic
1049758827 8:144322721-144322743 GCCCATCTAGACTGGAACACAGG + Intronic
1055202618 9:73684885-73684907 GGCCAGGTAGACTGGCAGAAGGG + Intergenic
1057829232 9:98394277-98394299 GGCCAGTTAGACTGGGATCTGGG + Intronic
1060578824 9:124724960-124724982 GGCCAGTTAGGCTATAAAACAGG - Intronic
1061818710 9:133210774-133210796 GGCGAATGAGACTGGGACACAGG - Intergenic
1186705618 X:12137427-12137449 GGAGAGCTAGACTGGAACACTGG + Intergenic
1190730878 X:53224825-53224847 GCCCAGCTAGGCTCGAACACCGG + Exonic
1192340292 X:70258521-70258543 GGGCAGATAGATTGTAACACGGG - Exonic
1195423729 X:104704298-104704320 GGCCAGTGTGGCTGGAACACAGG + Intronic
1196635279 X:117994629-117994651 GCCCAGTGAGACTGGAACAGAGG - Intronic
1198491810 X:137148655-137148677 GGCCAGCTAGTCTTGAACTCCGG + Intergenic