ID: 1146780756

View in Genome Browser
Species Human (GRCh38)
Location 17:35669582-35669604
Sequence CCAGTTATGAAGCACCTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146780756 Original CRISPR CCAGTTATGAAGCACCTACC AGG Intronic
902566392 1:17314407-17314429 CCATTTATGATACACCTACCTGG - Intronic
905710266 1:40096372-40096394 ACAGTTATTGAGCACCTACTAGG - Intronic
906170623 1:43721959-43721981 ACAGTTTTTGAGCACCTACCAGG + Intronic
907233087 1:53019095-53019117 CCAGATATGATGCACCTAGAAGG - Intronic
907584488 1:55604908-55604930 CCAGTTATGGAGCAATTTCCCGG + Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
908420427 1:63953633-63953655 CCATTTATTGAGCACCTACTAGG - Intronic
909566845 1:77062162-77062184 TTATTTATTAAGCACCTACCAGG + Intronic
909752780 1:79184189-79184211 TCATTTATTAAGCACCTACTTGG + Intergenic
912891299 1:113534580-113534602 CCAGTTAAGAAGCATGTACAAGG - Intronic
913658612 1:120985772-120985794 CCAATGTTGAAGCACCTTCCTGG - Intergenic
914009976 1:143768897-143768919 CCAATGTTGAAGCACCTTCCTGG - Intergenic
914648595 1:149677554-149677576 CCAATGTTGAAGCACCTTCCTGG - Intergenic
916260915 1:162841199-162841221 GCATTTATGAAGCACCCACTAGG - Intronic
917150248 1:171935809-171935831 CCAGTTGTTAAGCATTTACCAGG + Intronic
917865299 1:179188741-179188763 ACAGTTACTGAGCACCTACCAGG - Intronic
923824569 1:237485703-237485725 ATATTTATTAAGCACCTACCAGG - Intronic
1065093656 10:22260531-22260553 ACACTTCTGAAGCATCTACCAGG - Intergenic
1065201068 10:23313666-23313688 CAAGTTATTAACCACCTCCCTGG - Intronic
1066268956 10:33803348-33803370 CTAGTTAGGAATCACCTATCTGG - Intergenic
1067451350 10:46384013-46384035 CTAGTTGTGAAGCACCACCCAGG + Intronic
1067585892 10:47475743-47475765 CTAGTTGTGAAGCACCACCCAGG - Intronic
1069278279 10:66620185-66620207 ATAGTTATGGAGCACCTACTGGG - Intronic
1075102497 10:119516301-119516323 CCAGTTATTAAGCGCCCACTGGG + Intronic
1077983152 11:7322060-7322082 CGAGTTGTTAAGCATCTACCAGG - Intronic
1080828233 11:35866171-35866193 CCATTTATTTAGCACCTACTAGG - Intergenic
1081301229 11:41454472-41454494 ATATTTATTAAGCACCTACCAGG - Intronic
1084712332 11:70851636-70851658 TCAGTTATGGACCACCTAGCTGG + Intronic
1085962060 11:81472588-81472610 ACTGTTATGAAGAACCTACTAGG - Intergenic
1086229169 11:84547813-84547835 GCATTTATTAAGCACCTACTGGG - Intronic
1087450307 11:98312504-98312526 CCATTTAATAAGCAGCTACCTGG - Intergenic
1089324637 11:117648713-117648735 ACATTTATGGAGCAGCTACCAGG - Intronic
1093617910 12:21250552-21250574 ACAGTTACTAAGCACCTCCCAGG - Intergenic
1103326068 12:120121542-120121564 ACAGGTATCAAGCACCTACCAGG - Intergenic
1104511738 12:129385538-129385560 CCAGTTATATAGCACTTACTAGG - Intronic
1109472001 13:62820132-62820154 TCAGTTATAAAGCATCCACCTGG - Intergenic
1115246766 14:31303485-31303507 CCAATTAAGAAGCATCTACTAGG + Intronic
1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG + Intronic
1122944164 14:104998128-104998150 ACAGGTATGAACCACATACCGGG - Intronic
1124231737 15:27952126-27952148 CCTGTTATGAAACACCTGGCCGG + Intronic
1124647756 15:31451158-31451180 CCAGTAATGGAGCACCAACATGG - Intergenic
1125396229 15:39251145-39251167 CCATTTATTAGGCACCTACCAGG - Intronic
1126925006 15:53575309-53575331 CCAGTTATAAAGCATCTCCTTGG - Intronic
1127847163 15:62880815-62880837 ACATTTATTAAGCATCTACCAGG + Intergenic
1129162879 15:73756804-73756826 CCATTTACAGAGCACCTACCAGG - Intergenic
1129627749 15:77221627-77221649 TCTTTTATGAAGCACCTAACTGG + Intronic
1134838072 16:17378608-17378630 CCATTTATGAAGCACGTATTAGG + Intronic
1135877286 16:26214635-26214657 ACAGTAATTAAGCACCTATCAGG - Intergenic
1138181136 16:54940721-54940743 CCAGTTATCAAGCCCCAGCCAGG - Intergenic
1141094464 16:81153274-81153296 CCAGTGATGCAGTACCTACAGGG + Intergenic
1142014850 16:87739998-87740020 GCTGTTATGAAACACCTATCGGG + Intronic
1144528791 17:16015893-16015915 CAATTTATGAAGGACCTTCCTGG + Intronic
1146780756 17:35669582-35669604 CCAGTTATGAAGCACCTACCAGG + Intronic
1148352612 17:46951498-46951520 CCAGTTAAAAGGCACCTCCCAGG - Intronic
1153418657 18:4879538-4879560 CTAGTTATGAAGCATTTCCCTGG + Intergenic
1154315047 18:13297818-13297840 CCAGTGTTGAAGTCCCTACCAGG + Intronic
1156997303 18:43483079-43483101 CCAGGAATGTAGCACCTTCCAGG - Intergenic
1159911930 18:74153475-74153497 CCAGTTATGTATCAACTCCCAGG - Intronic
1159982201 18:74796964-74796986 GCAGTTATCAATCACCTAGCAGG - Intronic
1161066248 19:2239574-2239596 CCAGATACCAAGCACCCACCAGG - Intronic
1161255464 19:3306646-3306668 ACATTTATGAAGCACCTACTGGG + Intergenic
1164756697 19:30695148-30695170 CCAGGTATGAGGCACAGACCAGG + Intronic
1166882263 19:45936800-45936822 ACACTTATTAAGCACCTACTGGG + Exonic
928268578 2:29833568-29833590 CCTTTTATGGAGCACTTACCAGG + Intronic
930956890 2:57213641-57213663 CCATTTATGAAGCACATGCTGGG - Intergenic
932557816 2:72841107-72841129 CCATTTATGAAGCACCTGCTGGG + Intergenic
933159996 2:79013369-79013391 CCAGTGATGAAGGACATACAAGG - Intergenic
935313625 2:101809442-101809464 TCAGTTAAGAAGCATCTATCAGG - Intronic
937085017 2:119165861-119165883 CCAGTGAGAAAGCACCCACCAGG + Intergenic
940586299 2:155656199-155656221 CCATTTGTGAAGCCCTTACCAGG + Intergenic
941782797 2:169463006-169463028 ACATTTATGAAGCATCTACTAGG + Intergenic
942919160 2:181350111-181350133 CCAGTGATGAAGCAGATACAGGG + Intergenic
946045187 2:216815102-216815124 CAAGATATGAAGCCCCTACAGGG - Intergenic
947308383 2:228773345-228773367 ACAGTTATTAAGCACCTAGTAGG + Intergenic
1168789908 20:568970-568992 CCAGAGAGGAGGCACCTACCCGG - Intergenic
1170896131 20:20416156-20416178 CTATATATGAAGCATCTACCTGG + Intronic
1175478324 20:59292827-59292849 CTACTTATTAAGCACCTACTGGG - Intergenic
1178812385 21:35895951-35895973 CCACTTATTAAACATCTACCCGG - Intronic
1179830307 21:43992343-43992365 CCAGTTCTGCAGCCCCTTCCCGG - Intergenic
1181760698 22:25056889-25056911 ACACTTACAAAGCACCTACCAGG - Intronic
1182046390 22:27277615-27277637 CCATTTATTGAGCACCTACTAGG + Intergenic
1182066627 22:27435815-27435837 CCAGCTAGGAAGCCCCCACCCGG + Intergenic
1183096081 22:35553121-35553143 GCATTTATTAAGCACCTACTGGG + Exonic
1183245951 22:36693528-36693550 CCAGTTGTGATGATCCTACCTGG + Intronic
1183914565 22:41106867-41106889 ACAGTTGTGAGCCACCTACCAGG + Intronic
949564089 3:5229096-5229118 ACATTTATTAAGCACCTACTAGG + Intergenic
953030012 3:39173403-39173425 CAAGTCATGAAGCACATAGCAGG + Intergenic
953720716 3:45352496-45352518 CCATTTATTAAGCACCTGCCTGG + Intergenic
958624936 3:96612063-96612085 CCAAATATTAATCACCTACCAGG + Intergenic
963841621 3:150113735-150113757 TAAGTTATTAAGCACCTACTTGG + Intergenic
966659238 3:182396055-182396077 CCATTTATTAAGCATCTCCCAGG - Intergenic
967299329 3:187997165-187997187 CCATTTATGGAGCACCCACTGGG - Intergenic
969904316 4:10378978-10379000 GCAGTTATGAAGCATCAACTAGG - Intergenic
976188573 4:82467656-82467678 CCAGTTCTGAGGCAGCTACCAGG - Intergenic
977526656 4:98154373-98154395 CCAGTTATGAAGCACCTGTATGG + Intergenic
987431947 5:17845302-17845324 CCAGGTCTGAAGGACCTGCCTGG + Intergenic
988739231 5:34053578-34053600 CCAGTTTTTATGCACCTAACCGG + Intronic
996875740 5:128238673-128238695 CCATTTGTGAAGCTCCTGCCAGG + Intergenic
997035622 5:130187994-130188016 AGAGTTATGAAGCAGCTGCCAGG + Intergenic
997268013 5:132508893-132508915 CCAGGGCTGAAGCAGCTACCTGG + Intergenic
998044710 5:138977282-138977304 CCAGTTATGAAGCACTATCATGG + Intronic
1001558503 5:172653078-172653100 CCAGTAAAGCAGCACCAACCTGG - Intronic
1001649177 5:173303189-173303211 CCAGTTCTGAACCAGCTACTGGG - Intergenic
1001705504 5:173738400-173738422 TCACTTAACAAGCACCTACCAGG - Intergenic
1002080138 5:176732859-176732881 ACATTTATCAAGCACCTACCAGG + Intergenic
1007407502 6:41643486-41643508 ACATTTATTAAGCACCTACGAGG - Intronic
1012189571 6:96262685-96262707 CAAGTTATGAAACTACTACCAGG + Intergenic
1012294323 6:97501680-97501702 CCATTTATCAAACACCGACCAGG + Intergenic
1012454804 6:99392196-99392218 TCATTTATTCAGCACCTACCAGG + Intronic
1012652287 6:101770506-101770528 CCAATTATAAATCACCAACCAGG - Intronic
1014119364 6:117705472-117705494 CAAGATATGAAGCACGTAACAGG + Intronic
1014991081 6:128077635-128077657 CCAATTATGAAGTGCCTACGTGG + Intronic
1020471761 7:8545081-8545103 CATGTTATCAAGCAGCTACCAGG + Intronic
1023124514 7:36942185-36942207 CAGGTTGTGAAGCAGCTACCTGG - Intronic
1025213015 7:57031816-57031838 CCAGTTGTCAAGCATCTACGCGG + Intergenic
1025658938 7:63545008-63545030 CCAGTTGTCAAGCATCTACGCGG - Intergenic
1030980490 7:116180499-116180521 ACTGTTTTGAGGCACCTACCTGG - Intergenic
1035542794 8:454950-454972 CCAGTTGTTAAGCACTGACCAGG - Intronic
1038155617 8:24986826-24986848 CTATTTATTAAGCACCTCCCAGG + Intergenic
1038315953 8:26484535-26484557 CCACTTATGGACCACCTACCTGG + Intronic
1041733857 8:61089616-61089638 GAAGTTATGAAGAATCTACCAGG + Intronic
1050811556 9:9754288-9754310 CCCGTAATGAAGAACCTCCCAGG + Intronic
1056993228 9:91430298-91430320 CCATTTATGGAGCACCTGCTGGG + Intergenic
1058914156 9:109549435-109549457 CCACTTATTAAGCCCCTACTGGG - Intergenic
1059339013 9:113586925-113586947 CCATTTATGCAGCACCCACCAGG - Intronic
1061012038 9:127961481-127961503 CCTTTTATGAAGCCCCCACCAGG + Intronic
1187678866 X:21745736-21745758 CCATTTATTAAGCATCTACAGGG + Intronic
1198676617 X:139138087-139138109 CCATTTATGAAGCACTTACTGGG + Intronic