ID: 1146782134

View in Genome Browser
Species Human (GRCh38)
Location 17:35683783-35683805
Sequence CCCCATTTCTGGGTGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146782134_1146782141 14 Left 1146782134 17:35683783-35683805 CCTTGGGCCACCCAGAAATGGGG 0: 1
1: 0
2: 0
3: 23
4: 211
Right 1146782141 17:35683820-35683842 CCTGCATAAAGCAGAGACCCTGG 0: 1
1: 0
2: 1
3: 25
4: 199
1146782134_1146782143 19 Left 1146782134 17:35683783-35683805 CCTTGGGCCACCCAGAAATGGGG 0: 1
1: 0
2: 0
3: 23
4: 211
Right 1146782143 17:35683825-35683847 ATAAAGCAGAGACCCTGGAAGGG 0: 1
1: 0
2: 4
3: 24
4: 297
1146782134_1146782142 18 Left 1146782134 17:35683783-35683805 CCTTGGGCCACCCAGAAATGGGG 0: 1
1: 0
2: 0
3: 23
4: 211
Right 1146782142 17:35683824-35683846 CATAAAGCAGAGACCCTGGAAGG 0: 1
1: 0
2: 2
3: 20
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146782134 Original CRISPR CCCCATTTCTGGGTGGCCCA AGG (reversed) Intronic
900142421 1:1144280-1144302 CCCCCGGGCTGGGTGGCCCAGGG + Intergenic
900457670 1:2785400-2785422 CCCCCGTGCTGGGTGTCCCAGGG + Intronic
900596322 1:3481758-3481780 CACCATTTCTGGTTGGCATATGG - Intergenic
900902312 1:5525377-5525399 ACCCTTTTCTGGGTCTCCCATGG - Intergenic
901529913 1:9846453-9846475 TCCCTCTTCTGGGTTGCCCATGG - Intergenic
901670284 1:10851949-10851971 CACCGACTCTGGGTGGCCCAGGG + Intergenic
901765424 1:11496902-11496924 CCAGCTTTCTGGGTGGCCCTGGG - Intronic
902691209 1:18110907-18110929 CCCCAGTTAGGGGTAGCCCACGG + Intronic
903348009 1:22700056-22700078 CCCCATTCCTGTGTCCCCCAGGG + Intergenic
904349178 1:29893862-29893884 CCCCATATCTGAGTCACCCATGG + Intergenic
905800398 1:40838953-40838975 CCCCACTTGGGGGTGGGCCAAGG + Exonic
907258781 1:53200229-53200251 CCCCATATATGGCTGGCCCTTGG + Intronic
908253029 1:62280252-62280274 TCCCTGTTCTGGGAGGCCCATGG + Intronic
909608782 1:77532145-77532167 GCCCCTTTCTGGGCTGCCCAAGG - Intronic
909820546 1:80053889-80053911 GCCCTTTTCTGGGTTGGCCAAGG - Intergenic
910034823 1:82777203-82777225 CCCCCTTTCTGGGCTGGCCAAGG - Intergenic
912680910 1:111728241-111728263 CATCATTTCAGGGAGGCCCAGGG - Intronic
912819429 1:112854935-112854957 CCCCTTTTCTGGGCTGGCCAAGG - Intergenic
913234013 1:116764963-116764985 TCCTATCTATGGGTGGCCCAAGG + Intronic
922600483 1:226847818-226847840 CCACATTTCTGGGTTCACCATGG + Intergenic
923193504 1:231642327-231642349 GCCCCTTTCTGGGTTGGCCAAGG - Intronic
924945914 1:248846896-248846918 CCCTATTTCCGGGATGCCCATGG + Intronic
1064155644 10:12901114-12901136 CCCCATTGCTGGGTGTCCTGGGG + Intronic
1065117632 10:22497908-22497930 ACCCATTTCTGGGGGGTCTAGGG - Intergenic
1065634080 10:27712590-27712612 TCCCATGTCGGGGTGGCCAAAGG + Intronic
1067363136 10:45600685-45600707 CCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1067849183 10:49744192-49744214 CCCCAGGACTGAGTGGCCCATGG + Intronic
1071041154 10:81309508-81309530 CCCCTTTTCTGGGCTGACCAAGG - Intergenic
1073287378 10:102397020-102397042 CGCCGTTTCTGTGGGGCCCAAGG + Exonic
1074314534 10:112349683-112349705 GCCCCTTTCTGGGTTGCCCGAGG + Intergenic
1076385517 10:130052319-130052341 CTCCATGATTGGGTGGCCCAGGG - Intergenic
1076722756 10:132399923-132399945 CCCCAGTTGTGGGTTGCCTATGG + Intronic
1077198271 11:1292379-1292401 CCAGCTTTCTGGGTGGCACATGG + Intronic
1077330901 11:1983434-1983456 CCCCAGTTCTAGGTGGCAAATGG - Intronic
1077356673 11:2121983-2122005 CCCCATCTCTGTGTGCTCCACGG + Intergenic
1078182933 11:9027646-9027668 CCCCATTCCTGGGTGGCAACAGG - Intronic
1079708730 11:23653570-23653592 GCCCCTTTCTGGGCTGCCCAAGG - Intergenic
1079730620 11:23935146-23935168 CCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1080243330 11:30152239-30152261 CCCCATTTCTGCGTGGGTTAGGG + Intergenic
1080469266 11:32529330-32529352 ACCAATTTCTTGGTGGGCCAAGG + Intergenic
1081718434 11:45268027-45268049 GCCCATTTGTGGTTGGCCCAGGG + Intronic
1084061562 11:66678570-66678592 CCCTAGTTCTGGGTGGGACAGGG + Intergenic
1084147518 11:67272967-67272989 CCCCATTTCTCAGTGCCCCACGG - Intronic
1084673488 11:70621202-70621224 CCCAATTTCTGGGGTGTCCAAGG + Intronic
1084813676 11:71631970-71631992 CCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1084958802 11:72705333-72705355 TCCCACTTCTGGCTGACCCAGGG - Intronic
1086552446 11:88068989-88069011 GCCCCTCTCTGGGTGGGCCAAGG + Intergenic
1087526534 11:99320798-99320820 CCCAATGTCTGGGGAGCCCATGG - Intronic
1088003318 11:104908918-104908940 CCCCATTTCTTGGAGGCAGATGG + Intergenic
1088812114 11:113399065-113399087 CTCCACTTCCTGGTGGCCCAGGG + Exonic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089373630 11:117978909-117978931 GCCCCTTTCTGGGTTGGCCAAGG - Intergenic
1090844880 11:130522307-130522329 CCTCATTTCAGGTCGGCCCAGGG + Intergenic
1202813881 11_KI270721v1_random:38613-38635 CCCCAGTTCTAGGTGGCAAATGG - Intergenic
1091800747 12:3323200-3323222 CCCCCTCTCTGGCTGCCCCATGG + Intergenic
1092350577 12:7752482-7752504 GCCCCTTTCTGGGTTGGCCAAGG - Intergenic
1098128307 12:67322729-67322751 CTCCATTTCAGGGAGGCGCAAGG - Intergenic
1100211941 12:92406940-92406962 CCCCCTTTCTGGGCTGGCCAAGG - Intergenic
1101065162 12:101013337-101013359 CCCCATGTCTTAGTTGCCCAAGG - Intronic
1102347686 12:112170052-112170074 CCCCATTTTTGGCAGGCACATGG + Intronic
1104639721 12:130459754-130459776 CGTCATTTCTGGGAGTCCCATGG - Intronic
1104931106 12:132339872-132339894 CCACACTTTTGGGGGGCCCAGGG + Intergenic
1105474309 13:20717734-20717756 CCCCATGGCTGCGTGGGCCATGG - Intronic
1105892241 13:24689992-24690014 CTCCTTTTCTAGGAGGCCCAGGG + Intronic
1106381254 13:29241860-29241882 GCCCATTTCTGGGTGGGCAGGGG + Intronic
1107438360 13:40402245-40402267 CAGCATTTCAGGGTGGCCCTGGG - Intergenic
1109858771 13:68170918-68170940 GCCCCTTTCTGGGCTGCCCAAGG + Intergenic
1112013809 13:95314678-95314700 CCCCATTTCTAGTTGCCCTAAGG - Intergenic
1113412254 13:110100690-110100712 CAACATTCCTGGGTGGTCCAGGG - Intergenic
1113672776 13:112186183-112186205 GCCCATTCCTGCGTGGCCCCAGG + Intergenic
1115961329 14:38838006-38838028 CTGCATTTCTGGGGAGCCCATGG + Intergenic
1116114552 14:40630060-40630082 GCCCCTTTCTGGGCTGCCCAAGG - Intergenic
1116254116 14:42528077-42528099 TCCCATTTCTGGGTAGTCCTAGG + Intergenic
1116514360 14:45787483-45787505 CCTCCTTTCAGGGTGACCCAGGG - Intergenic
1117731214 14:58723668-58723690 ACCCATTTGTGTGTGGCCCTGGG + Intergenic
1118778468 14:68989523-68989545 CCCCATTTCTGGTTGGCCACAGG + Intergenic
1119691530 14:76676492-76676514 CCCCAAGTCTTGGTGGCCCTGGG - Intergenic
1120439168 14:84513330-84513352 GCCCCTTTCTGGGCTGCCCAAGG - Intergenic
1121583856 14:95049533-95049555 CCCCAGCTCTGGCTGGCACAGGG + Intergenic
1122088979 14:99325672-99325694 CCACATATCTGGGTGCCCCATGG + Intergenic
1122261037 14:100523240-100523262 CCACATTTCTGGGTCACCCTTGG - Intronic
1122891961 14:104736161-104736183 CCCCACTGCTGGGAGGGCCAGGG - Intronic
1123852019 15:24367710-24367732 CCCCATTTCTGAGGGGGTCATGG + Intergenic
1126088936 15:45034773-45034795 GCCCCTTTCTGGGTTGGCCAAGG + Intronic
1127854875 15:62946040-62946062 CCCCATCTCTGGGTGGCTGATGG - Intergenic
1128338708 15:66804996-66805018 TCCCTCTTCTGGGTGGCCCTTGG + Intergenic
1128520913 15:68374410-68374432 CCACATTTGAGGCTGGCCCAAGG - Intronic
1128562050 15:68675110-68675132 CCCAATTTCAGTGTGGCTCACGG - Intronic
1129707287 15:77801951-77801973 CCCCAATTCTGGGTTCCCCAGGG - Intronic
1129845330 15:78765468-78765490 CCCCATTCCTGGGCAGCACAGGG - Intronic
1130651413 15:85764122-85764144 CTCCATTTCCTGGTGACCCAGGG + Intronic
1132352026 15:101145734-101145756 CGCCATTTCTGGGGGCCACACGG - Intergenic
1132587051 16:710157-710179 GCATGTTTCTGGGTGGCCCAGGG + Intronic
1132717937 16:1301383-1301405 CCGCAGGTCTGGGTGGCCGAGGG - Intergenic
1133281963 16:4671686-4671708 CCCCATTCCTGGGCTGCCCTGGG - Intronic
1133642947 16:7735254-7735276 CCACATTTCTGGATGACCCTGGG + Intergenic
1134037219 16:11040172-11040194 CGCTATGTCTGGGTGGCCCAAGG + Intronic
1135299447 16:21313202-21313224 GCCCATTTCTGGGCTGGCCAAGG - Intergenic
1137442455 16:48508641-48508663 GCCCCTTTCTGGGTTGGCCAAGG + Intergenic
1137767866 16:50991687-50991709 TCCCATTTCTCCCTGGCCCATGG + Intergenic
1139652544 16:68369747-68369769 CCCCACTTCTGGTTCGTCCATGG - Intronic
1141984532 16:87571211-87571233 CCCCACCGCTGGGAGGCCCAAGG - Intergenic
1142287908 16:89178945-89178967 CCCCAGCCCTGGCTGGCCCAGGG + Intronic
1142708930 17:1713145-1713167 CCCCATGCAAGGGTGGCCCAAGG - Intergenic
1143360656 17:6366694-6366716 TCCTATTTCTGGGGAGCCCAAGG - Intergenic
1143655590 17:8291659-8291681 CCCCAGTTCTTGGGTGCCCAGGG - Intronic
1143968008 17:10770722-10770744 CCCCAGCTCTGAGTGGCCAAGGG - Intergenic
1146467244 17:33095917-33095939 CCCCATGCCTGGGTGACACAGGG - Intronic
1146617979 17:34371840-34371862 TCCCATATCTGGGTGGTACAAGG - Intergenic
1146782134 17:35683783-35683805 CCCCATTTCTGGGTGGCCCAAGG - Intronic
1147137221 17:38441350-38441372 TCTCATGTCTGGCTGGCCCAAGG + Intronic
1147962880 17:44178392-44178414 CCCCATGTCAGGCTGTCCCATGG + Exonic
1149289101 17:55198232-55198254 CCCCATTTCTGTGTGGCAGATGG - Intergenic
1152379179 17:79933660-79933682 CCCAATTTCTGCGTGGCCTTTGG - Exonic
1156631457 18:38974369-38974391 CCCCTGTTTTGGGTGGGCCAGGG + Intergenic
1159230737 18:65605193-65605215 CCCCCTTTCTGGGCTGGCCAAGG + Intergenic
1160861633 19:1239668-1239690 CCCCACTCCAGGGTCGCCCACGG - Intergenic
1160981454 19:1818400-1818422 CCCCAGTTCTGGGGGCCTCAAGG + Intronic
1161026200 19:2038500-2038522 CCGCATTCCTGGGTGCCCGAAGG + Exonic
1161033603 19:2071699-2071721 CCCTTTTTCTGTGTGGCCCCTGG - Exonic
1161478698 19:4499996-4500018 CCCCCTCTCTGGGCGTCCCAGGG - Intronic
1161491850 19:4566672-4566694 CCACATGTCTGCGTGCCCCAGGG + Intergenic
1165116797 19:33533509-33533531 CCCTCCTTCTGGATGGCCCAGGG + Intergenic
1165117466 19:33537527-33537549 CTCCATTTCTGTATTGCCCATGG + Intergenic
1165308858 19:35018820-35018842 CCCCACTCAGGGGTGGCCCAGGG - Intronic
1166885571 19:45959054-45959076 CCCCATTTCTGTCTGGCACCGGG + Intronic
1168581895 19:57561903-57561925 CCTCTTTTCTGGATGCCCCAGGG + Intergenic
925844022 2:8019772-8019794 CCCAATGTCTGTGTGGCCCATGG + Intergenic
927658475 2:24971821-24971843 CCCCACTTCGGCGTTGCCCATGG + Exonic
928205260 2:29279334-29279356 ACCCATGTGTGGGTGGCCCCGGG - Intronic
928591919 2:32826019-32826041 CCCCATTTCTGGGTGGCAAGTGG + Intergenic
928892588 2:36221339-36221361 CCCCATCTCTGGGTGGGGCTAGG + Intergenic
930691664 2:54371494-54371516 CCTCAGTTCTGAGTGGCCCTGGG + Intronic
932697789 2:73971076-73971098 CCCCTTTGCTGGGTCTCCCAAGG - Intergenic
933660656 2:84924834-84924856 CCCCTTTTCTGTGGGGCCGACGG + Intergenic
934570968 2:95373126-95373148 CCACCATTCTGTGTGGCCCAGGG + Intronic
934636791 2:95996566-95996588 CCACTTTTCCTGGTGGCCCAAGG - Intergenic
934654039 2:96108162-96108184 CCAAATTGCTGGGTGGCCCTGGG - Intergenic
934898437 2:98138942-98138964 GCCCATTTCTGGGCTGACCAAGG + Intronic
935827102 2:106962750-106962772 CCCCATGCCTGGGCAGCCCAGGG - Intergenic
935879071 2:107542963-107542985 CCCCATTTTTCTCTGGCCCAAGG - Intergenic
935956975 2:108386941-108386963 GCCTATTTCTGGGAGGCCCAAGG - Intronic
936152526 2:110029669-110029691 CTCAGCTTCTGGGTGGCCCATGG + Intergenic
936192154 2:110341743-110341765 CTCAGCTTCTGGGTGGCCCATGG - Intergenic
938308338 2:130269078-130269100 CCCTGTCTCTGGGGGGCCCATGG - Intergenic
938446991 2:131387758-131387780 CCCTGTCTCTGGGGGGCCCATGG + Intergenic
938935368 2:136122963-136122985 CCACATTTCTGGGAGCACCAAGG - Intergenic
939281698 2:140073735-140073757 GCCCCTTTCTGGGTTGGCCAAGG + Intergenic
940895623 2:159080049-159080071 CCCCTTTTCTGGGTGGCAGTAGG - Intronic
942321773 2:174742203-174742225 CCCCACCTCTGGGTGGACCATGG + Intergenic
943440744 2:187924645-187924667 CCCTTTTTCTGGCTGGCCAAAGG - Intergenic
1170537495 20:17355828-17355850 GCCCATTTCTGGGAGACACAGGG + Intronic
1170891598 20:20380785-20380807 CACCATTTTTGGGTGGCCATGGG + Intergenic
1171250107 20:23640177-23640199 CTCCATTTCTGGGAAGCTCAAGG - Intergenic
1172308981 20:33902328-33902350 GACCACTTCTGGGTGGCCCCAGG - Intergenic
1172429857 20:34880672-34880694 CCCAATGTCTGGGTGGCCCTGGG - Intronic
1172801144 20:37577094-37577116 CCACAGCTCTTGGTGGCCCAGGG + Intergenic
1172803204 20:37592713-37592735 GCCCAGTTGTGGGTGGCCGAGGG + Intergenic
1174553628 20:51378817-51378839 CACCAGCTCTGGGTGGCCCAGGG + Intergenic
1175210005 20:57348335-57348357 CCCCGTTTCTGGGCTGGCCAAGG + Intergenic
1175257633 20:57656781-57656803 CCCCTTTTCAGGGTGACCCTGGG - Intronic
1175286623 20:57840959-57840981 CACCATTTCTGGGTGTCCTCAGG + Intergenic
1175742164 20:61427302-61427324 GCCCATTTCTCCGTGGGCCAAGG + Intronic
1175975227 20:62707623-62707645 CTCCATGTCTGGGTTGCCCAGGG - Intergenic
1178487665 21:33029213-33029235 CCCCTTTTCGGGGTGGCACACGG - Intergenic
1180863457 22:19101408-19101430 CACCATTACTTGGTTGCCCATGG - Intronic
1181479189 22:23187066-23187088 GTTCATTTCTGGGTGTCCCAGGG + Intronic
1183337817 22:37260651-37260673 CTCCAGCTCTGGGTGGTCCAGGG + Intergenic
1183428468 22:37751881-37751903 CCCCACTCCTGGGCTGCCCAGGG - Intronic
1183673724 22:39288543-39288565 CCAGTTTTCTGGGAGGCCCAGGG + Intergenic
949879673 3:8651531-8651553 CCCCATTTTTGTGTGGCCCCAGG - Intronic
950105637 3:10386624-10386646 CCCCATTTCAGGATGACCCTAGG - Intronic
951146641 3:19234665-19234687 GCCCCTTTCTGGGCTGCCCAAGG - Intronic
952016073 3:28958947-28958969 CCCCATTTCTGCAGGGTCCAGGG + Intergenic
952884320 3:38003261-38003283 CCCCACTTCTGGGAGGCCCTGGG + Exonic
954040953 3:47887145-47887167 CCCCCTTTCTGGGCTGGCCAAGG + Intronic
955449428 3:59050797-59050819 GCCCCTTTCTGGGTTGGCCAAGG + Intergenic
956794298 3:72704076-72704098 ATCCACTACTGGGTGGCCCAGGG + Intergenic
957386393 3:79502196-79502218 GCCCCTTTCTGGGCGGGCCAAGG + Intronic
960683166 3:120270216-120270238 CCCCATGTCTGGGGAGACCAGGG - Intronic
961505681 3:127369333-127369355 ACCCAGTACTGGGAGGCCCATGG + Intergenic
965848335 3:172990831-172990853 CCCCTTTTCTGTTTGGACCAGGG + Intronic
968591103 4:1460083-1460105 CCCCATCTCTGAGTGGCCCTGGG + Intergenic
968814301 4:2813971-2813993 CCCCATTTGTGGGAGCCACAGGG - Intronic
969611318 4:8229163-8229185 CCCCATTTGTGGGTGGGACGTGG - Intronic
969674044 4:8605172-8605194 CCCCAGCTGTGTGTGGCCCAGGG - Intronic
972745677 4:41930245-41930267 CCCCTTTTCTGCGTGGCAGATGG + Intergenic
976600701 4:86935251-86935273 CCCCAGCCCTGGGTGGCGCAGGG - Intronic
977682074 4:99807808-99807830 CACTGTTCCTGGGTGGCCCATGG - Intergenic
979825761 4:125230010-125230032 GCCCATTTCTGGGCTGGCCAAGG - Intergenic
982205719 4:152995896-152995918 CCCCATGTGTGGGTGTCCCATGG - Intergenic
984662196 4:182386500-182386522 GCCCCTTTCTGGGTTGACCAAGG + Intronic
984825349 4:183919380-183919402 CCCCACCTCTAGCTGGCCCACGG - Intronic
987377687 5:17251738-17251760 CCACATTTCTGGCTGGGCGATGG + Intronic
988132104 5:27119837-27119859 GCCCATTTCTGGGCTGGCCAAGG + Intronic
991992985 5:72359884-72359906 CCCCATTACTGTGTGGCCCTGGG + Intronic
993086348 5:83368210-83368232 CCCCAGTTCAGGGTGACCCTTGG + Intergenic
994987526 5:106956379-106956401 CCCCGTTTCTCGGTGCCACAAGG - Intergenic
995221852 5:109657041-109657063 CCACATTTCTGGGTTGGCCCAGG - Intergenic
995413906 5:111888326-111888348 CCCCATTGCTGGGTGGCGGGGGG + Intronic
996585942 5:125088643-125088665 GCCCCTTTCTGGGTTGGCCAAGG + Intergenic
1003947223 6:11087157-11087179 GCCCCTTTCTGGGCGGGCCAAGG + Intergenic
1004093907 6:12533741-12533763 CTCCATTTCTGGGTAGTCTAAGG - Intergenic
1006795588 6:36730515-36730537 CCCCATCTCAGCGTGGGCCACGG - Intronic
1007704875 6:43784447-43784469 CCCCATTCCTGGGGGCCCCTGGG - Intronic
1007721309 6:43887049-43887071 CTCCATTGCTGGGAGGGCCAGGG - Intergenic
1011082921 6:83509245-83509267 CTATCTTTCTGGGTGGCCCAAGG - Intergenic
1019991976 7:4698435-4698457 CCCCATTTTTGGGTGTCCTGGGG - Intronic
1021363039 7:19740663-19740685 CCCCTTTTTGGGGTGGGCCAAGG + Intronic
1022547299 7:31201112-31201134 CCCCATTTCTGGGGAGTCCCTGG - Intergenic
1023853059 7:44160949-44160971 CCCCATTTCTTAGTTGCTCAGGG + Intronic
1026842038 7:73674841-73674863 GCCCAGTTCTGGGTGGGCCATGG + Intergenic
1026848491 7:73710734-73710756 CCTCATTTCTGAGTGCCTCACGG + Intronic
1026908945 7:74081568-74081590 CCCCAGTTCTGGGGGACTCATGG - Intergenic
1027463587 7:78486408-78486430 CCCAATTTTTGTGTGGCCAATGG + Intronic
1029177414 7:98674838-98674860 CCCCAGTTCCTGGTGTCCCATGG + Intergenic
1029548763 7:101225259-101225281 CCCCTGGTCTGGGTGGCCCTGGG + Intergenic
1032150624 7:129426567-129426589 CCTGATTTCTGGGGAGCCCAAGG - Intronic
1033280627 7:140003942-140003964 GACCATTTCTCGGTGCCCCATGG - Intronic
1035056866 7:156041621-156041643 CCCTGTGTCTGGGGGGCCCAGGG - Intergenic
1035151244 7:156874423-156874445 GCCCCTTTCTGGGTGGGCCGAGG - Intronic
1035155155 7:156906235-156906257 GCCCTTTGCTGGGCGGCCCAGGG + Intergenic
1035203788 7:157281891-157281913 CCACAGGGCTGGGTGGCCCAGGG + Intergenic
1045406144 8:101868512-101868534 CCCCATTTCTGCCTGGCAGATGG + Intronic
1048855723 8:138685222-138685244 TCCCTTTTCCGGGTGGCCCAGGG + Exonic
1049594955 8:143479032-143479054 CCCCATTCCCGGGAGGCCCTGGG - Intronic
1054734817 9:68740127-68740149 AGCCAGTTCTGTGTGGCCCAAGG + Intronic
1057275283 9:93673090-93673112 CCCCATCTCAGGGTGACACATGG + Intronic
1058890139 9:109354447-109354469 CCCCCTCCCAGGGTGGCCCAAGG + Intergenic
1059438090 9:114288490-114288512 CCCGATCTCCAGGTGGCCCAGGG - Exonic
1059719329 9:116944350-116944372 TCCCATGTCTGTGTGGCACATGG - Intronic
1187675240 X:21709955-21709977 ACCCATTTCTGGGTTGCAGATGG - Intronic
1190101891 X:47528230-47528252 CCCCATGTCACAGTGGCCCAGGG + Intergenic
1195252976 X:103065904-103065926 CCACATTTCTGGGTTGGTCAAGG - Intergenic
1199896490 X:152131940-152131962 CACCATTTCAGGGTGGCCTGTGG - Intergenic