ID: 1146787334

View in Genome Browser
Species Human (GRCh38)
Location 17:35731741-35731763
Sequence CGCCCCGACTGGGCAGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 642
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 629}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146787318_1146787334 0 Left 1146787318 17:35731718-35731740 CCCCCGCGCGCCCGCCCTGAGCC 0: 1
1: 1
2: 1
3: 48
4: 366
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629
1146787321_1146787334 -3 Left 1146787321 17:35731721-35731743 CCGCGCGCCCGCCCTGAGCCCGC 0: 1
1: 1
2: 8
3: 57
4: 508
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629
1146787317_1146787334 9 Left 1146787317 17:35731709-35731731 CCGCATCTGCCCCCGCGCGCCCG 0: 1
1: 0
2: 1
3: 17
4: 218
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629
1146787314_1146787334 20 Left 1146787314 17:35731698-35731720 CCCTCGGCGGCCCGCATCTGCCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629
1146787311_1146787334 26 Left 1146787311 17:35731692-35731714 CCTACCCCCTCGGCGGCCCGCAT 0: 1
1: 0
2: 4
3: 9
4: 93
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629
1146787312_1146787334 22 Left 1146787312 17:35731696-35731718 CCCCCTCGGCGGCCCGCATCTGC 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629
1146787316_1146787334 10 Left 1146787316 17:35731708-35731730 CCCGCATCTGCCCCCGCGCGCCC 0: 1
1: 0
2: 1
3: 25
4: 297
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629
1146787320_1146787334 -2 Left 1146787320 17:35731720-35731742 CCCGCGCGCCCGCCCTGAGCCCG 0: 1
1: 0
2: 4
3: 46
4: 439
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629
1146787322_1146787334 -10 Left 1146787322 17:35731728-35731750 CCCGCCCTGAGCCCGCCCCGACT 0: 1
1: 1
2: 0
3: 30
4: 335
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629
1146787319_1146787334 -1 Left 1146787319 17:35731719-35731741 CCCCGCGCGCCCGCCCTGAGCCC 0: 1
1: 0
2: 4
3: 45
4: 425
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629
1146787315_1146787334 19 Left 1146787315 17:35731699-35731721 CCTCGGCGGCCCGCATCTGCCCC 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629
1146787313_1146787334 21 Left 1146787313 17:35731697-35731719 CCCCTCGGCGGCCCGCATCTGCC 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146787334 Original CRISPR CGCCCCGACTGGGCAGGCGG GGG Exonic
900326226 1:2109974-2109996 CTCCCAGTCTGGGCAAGCGGAGG + Intronic
900364262 1:2304417-2304439 CGCCCCCAGTGGGCTGGAGGCGG + Exonic
900654245 1:3747195-3747217 CGGCCCGCCTGGGCAGGCGGCGG + Intergenic
901030708 1:6305385-6305407 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
901880517 1:12191270-12191292 CAGCCCCACGGGGCAGGCGGTGG + Intronic
902019080 1:13329433-13329455 CGCCCCGTCCGGGAGGGCGGTGG + Intergenic
902821909 1:18948608-18948630 CTCCCCTCGTGGGCAGGCGGCGG + Intronic
902930689 1:19729263-19729285 CCCCGCTACTTGGCAGGCGGAGG - Intronic
903103475 1:21053523-21053545 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
903637501 1:24832917-24832939 CGCCCCGTCCGGGAGGGCGGTGG - Intronic
903921378 1:26803519-26803541 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
903923608 1:26818082-26818104 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
903996499 1:27308101-27308123 GGCCCAGGCTGGGCAGGCAGGGG - Exonic
904532260 1:31177018-31177040 CGCCCCGTCCGGGAAGGAGGTGG + Intergenic
904795029 1:33052000-33052022 CGGCACGGCTGGCCAGGCGGGGG - Intronic
905192156 1:36243884-36243906 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
906399993 1:45497736-45497758 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
906761559 1:48382735-48382757 CGGGGCGACTGGCCAGGCGGGGG + Intronic
906761722 1:48383092-48383114 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
907402583 1:54233693-54233715 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
907453744 1:54562469-54562491 CGGCACGGCTGGCCAGGCGGGGG + Intronic
908544035 1:65147585-65147607 CTCCGCGACTGGGCGGGCGGAGG + Intronic
911486648 1:98512774-98512796 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
912298439 1:108489806-108489828 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
912735320 1:112145093-112145115 GGCCCCAGCTGGGCAGGGGGAGG + Intergenic
913306153 1:117430234-117430256 CGGCACGGCTGGCCAGGCGGGGG + Intronic
914231494 1:145767079-145767101 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
914908957 1:151769294-151769316 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
915112826 1:153575325-153575347 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
915208416 1:154287768-154287790 CGCCCCGTCCGGGCGGGAGGTGG + Intergenic
915511951 1:156391347-156391369 CCCCCAAACTGGGCAGGCCGAGG + Intergenic
917375861 1:174349742-174349764 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
917583112 1:176396741-176396763 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
917790544 1:178496316-178496338 CGCCCCGACTCTGCAGCCAGAGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
919423911 1:197405885-197405907 CACCCCGTCTGGGAAGGAGGTGG + Intronic
921023634 1:211258989-211259011 CGACCCGACTGGGCGACCGGGGG - Intronic
921044077 1:211460841-211460863 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
921140029 1:212298458-212298480 CGCCCCGTCCGGGAGGGCGGTGG - Intronic
921142609 1:212321201-212321223 CGCCCCGTCTGGGAAGGATGTGG - Intronic
921198108 1:212779211-212779233 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
921238016 1:213151609-213151631 CGCCCCGTCTGGGATGGAGGTGG - Intronic
921414259 1:214869786-214869808 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
922102719 1:222488375-222488397 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
922503776 1:226114988-226115010 CGCCCCGACCGGGAGGGAGGTGG - Intergenic
922925421 1:229343112-229343134 CGCCCCCACGGAGCGGGCGGAGG - Intronic
923021572 1:230168109-230168131 CCCCCTGACTGGGGAGGCGGTGG + Intronic
923792963 1:237127473-237127495 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
1064554312 10:16533397-16533419 CACCTCAACTGGGGAGGCGGAGG - Intergenic
1065738087 10:28772024-28772046 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1066085808 10:31970970-31970992 CGCCCCGTCCGGGAGGGCGGTGG + Intergenic
1066325377 10:34353113-34353135 CGCCCCGTCTGGGAAGTGGGGGG + Intronic
1066437368 10:35406870-35406892 CGCCCCGACGGGGACGGAGGTGG - Intronic
1066653862 10:37681912-37681934 CGCCCCGGCTGGGCTGCCGTGGG + Intergenic
1067026566 10:42847691-42847713 CGCCCCGACCGGGAGGGAGGTGG + Intergenic
1067145211 10:43689339-43689361 CGCCTCGCCTGGGCAGCTGGAGG - Intergenic
1067391148 10:45865377-45865399 CGCCCCGTCTGGGCGGTGGGGGG - Intergenic
1068005950 10:51392868-51392890 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1069645405 10:69992969-69992991 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1069698918 10:70407739-70407761 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1069741295 10:70687696-70687718 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1069898270 10:71692286-71692308 AGCCCCGACTGGGGAGGCAAGGG - Intronic
1069928988 10:71869747-71869769 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1069929991 10:71875785-71875807 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1069930015 10:71875834-71875856 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1070135531 10:73689964-73689986 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1070318081 10:75333611-75333633 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1070318103 10:75333660-75333682 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1072013349 10:91323225-91323247 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1072149688 10:92674699-92674721 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1072149973 10:92675341-92675363 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1074152029 10:110767173-110767195 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1074377420 10:112951367-112951389 CGCCCCGACCGGGCCGGCGCAGG - Intronic
1075137141 10:119795138-119795160 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1075842814 10:125518583-125518605 CGCCCCGTCCGGGAAGGAGGTGG + Intergenic
1076068790 10:127469538-127469560 TGCCCCCACTGGGTAGGTGGGGG - Intergenic
1076148132 10:128141415-128141437 AGCCCCTACTGGGGAGGCTGAGG - Intergenic
1077419827 11:2444962-2444984 CGCCCGGGCTGGGCCGGCAGCGG + Intronic
1077668742 11:4137956-4137978 CGCCCCATCTGGGAAGGAGGTGG - Intronic
1079039814 11:17050564-17050586 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1080098173 11:28430704-28430726 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1080860349 11:36145361-36145383 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1081288938 11:41304552-41304574 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1081288962 11:41304601-41304623 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1081289030 11:41304748-41304770 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1081784768 11:45738537-45738559 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1081861011 11:46333306-46333328 CGCTGGGACTGGGCTGGCGGCGG + Intronic
1081950210 11:47038162-47038184 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1083079144 11:60073108-60073130 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1083208232 11:61166396-61166418 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1083255285 11:61491700-61491722 CGCCCTGTCTGGGCATGCAGAGG + Intergenic
1083265760 11:61546203-61546225 CGCCGCGGCGGGGCTGGCGGTGG - Exonic
1083750029 11:64755772-64755794 AGCCCTGCCTGGGCAGACGGTGG + Intronic
1083865668 11:65451651-65451673 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1084049080 11:66588177-66588199 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1084544115 11:69805371-69805393 CAGGCCGACTGGGCAGGCAGGGG + Intergenic
1084643095 11:70437451-70437473 CACACCGACTGGGCAGACAGTGG - Intergenic
1084745494 11:71167424-71167446 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1084968158 11:72755155-72755177 CGCCCCGCCGGGTCAGGGGGTGG + Intronic
1085097825 11:73775229-73775251 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1085360090 11:75877967-75877989 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1085563276 11:77490436-77490458 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1086122503 11:83316744-83316766 CGCCCCGCCTGGGAGGGAGGTGG - Intergenic
1086366193 11:86111006-86111028 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1086447026 11:86879653-86879675 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
1086881604 11:92157951-92157973 CGCCCCGTCCGGGAAGGAGGTGG + Intergenic
1087628774 11:100626338-100626360 CGCTCGAACTGGGGAGGCGGAGG - Intergenic
1087948780 11:104194982-104195004 CGCCCCGACCGGGAGGGAGGTGG + Intergenic
1088602634 11:111495112-111495134 CGCAGCGACTGGGCACGTGGTGG - Intronic
1088658894 11:112027001-112027023 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1090181577 11:124704637-124704659 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1090751633 11:129750921-129750943 CGCCGGTGCTGGGCAGGCGGCGG + Intergenic
1090791102 11:130091745-130091767 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1091218622 11:133918225-133918247 CTCCTCGGCTGGGCGGGCGGGGG - Intronic
1091378820 12:42658-42680 CGCCCCGTCCGGGAGGGCGGTGG + Intergenic
1092331286 12:7589864-7589886 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1094855519 12:34401164-34401186 CCTCCCCACTGGGCAGGCGCGGG + Intergenic
1095439521 12:42227808-42227830 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1096022288 12:48333119-48333141 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1096041391 12:48520486-48520508 CGCCCCGTCTGGGAGGGAGGCGG - Intronic
1096082476 12:48842378-48842400 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
1096951769 12:55479953-55479975 CGCACGCACTGGGCAGGCTGAGG + Intergenic
1097110058 12:56651769-56651791 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1097149211 12:56963879-56963901 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1097246473 12:57610294-57610316 CGCCCTCCCTGGGCAGGAGGGGG + Exonic
1098412797 12:70202368-70202390 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1098412961 12:70202725-70202747 CGGGGCGACTGGCCAGGCGGGGG - Intergenic
1098883781 12:75941937-75941959 CGCCCCGACCGGGAGGGAGGTGG + Intergenic
1098883854 12:75942113-75942135 CGCCCCGTCCGGGAAGGAGGTGG + Intergenic
1100570280 12:95840478-95840500 CGCCCCGTCCGGGAGGGCGGTGG - Intergenic
1100582420 12:95948339-95948361 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1101317616 12:103643809-103643831 CGCCCCGACCGGGAGGGAGGTGG + Intronic
1101393431 12:104323589-104323611 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1102061082 12:109931592-109931614 TGCCCCTACTGTGTAGGCGGTGG + Exonic
1102174877 12:110867585-110867607 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1102186258 12:110950828-110950850 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1102293967 12:111723330-111723352 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1102846762 12:116193042-116193064 CGCCTGAACTGGGGAGGCGGAGG + Intronic
1103457207 12:121076529-121076551 CGCCCCGTCCGGGAAGGAGGTGG + Intergenic
1103457385 12:121076931-121076953 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1103457409 12:121076980-121077002 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1103779700 12:123390038-123390060 CGCCCCGAATGCGCTGGCTGTGG + Intronic
1104712562 12:130996667-130996689 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1105248519 13:18674062-18674084 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1105527026 13:21186502-21186524 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1105556113 13:21448444-21448466 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
1106559985 13:30839308-30839330 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1107562739 13:41572202-41572224 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1108608835 13:52064477-52064499 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1110711904 13:78659176-78659198 CGCCAAGACTGGGCACGCGCGGG + Exonic
1112055906 13:95690591-95690613 CGGGGCGACTGGCCAGGCGGGGG + Intronic
1112580770 13:100674812-100674834 CGCCCGGACCTGGCAGGGGGAGG + Intronic
1113194089 13:107783043-107783065 CGCCCCGACCGGGAGGGAGGTGG + Intronic
1113655907 13:112067728-112067750 GGCCCCGCCGGGGCGGGCGGCGG + Exonic
1114507995 14:23232669-23232691 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1114508041 14:23232764-23232786 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1115297064 14:31840456-31840478 CCCACCTACTGGGGAGGCGGAGG + Intronic
1115609746 14:35039190-35039212 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1115847491 14:37555329-37555351 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1115847539 14:37555427-37555449 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1116480427 14:45389380-45389402 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1116502239 14:45635532-45635554 CGCCCCGTCTGGGAAGTGGGGGG + Intergenic
1117277187 14:54203729-54203751 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1117277263 14:54203905-54203927 CGCCCCGTCCGGGAAGGAGGTGG + Intergenic
1117596868 14:57333782-57333804 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1118253218 14:64182994-64183016 CGGGGCGACTGGCCAGGCGGGGG + Intronic
1118340776 14:64894782-64894804 CGCCCCGTCCGGGAGGGCGGTGG - Intergenic
1118428510 14:65692465-65692487 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1118517478 14:66545360-66545382 CGGGGCGACTGGCCAGGCGGGGG + Intronic
1118776697 14:68978320-68978342 CGCCCCCACAGGGCCCGCGGGGG + Intronic
1119254246 14:73184063-73184085 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1119835769 14:77747731-77747753 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1119844328 14:77817156-77817178 CGCTCCAACCTGGCAGGCGGAGG + Intronic
1120406507 14:84099467-84099489 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1121093907 14:91202603-91202625 CCCTCCGGCTGGGCAGGCAGAGG + Intronic
1121306733 14:92911720-92911742 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1202848126 14_GL000009v2_random:200164-200186 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1124132552 15:27003863-27003885 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1125566642 15:40683075-40683097 CGCCCCGTCCGGGAAGGAGGTGG + Intergenic
1125659216 15:41382617-41382639 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1126516980 15:49549971-49549993 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1127072990 15:55303095-55303117 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1127154182 15:56110070-56110092 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1128489835 15:68134853-68134875 CGCCCCGTCCGGGAGGGCGGTGG - Intronic
1128970529 15:72101668-72101690 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1129428471 15:75481450-75481472 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1129431733 15:75504619-75504641 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1130340770 15:82998194-82998216 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1130428277 15:83822136-83822158 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1131150207 15:90043017-90043039 GGCCCAGCCTGAGCAGGCGGCGG + Intronic
1131379293 15:91950354-91950376 GGCCCTGGCTGGGCAGGCAGGGG + Intronic
1132553033 16:560992-561014 CACCCCCACAGGGCAGGAGGGGG - Intronic
1132776796 16:1599384-1599406 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1132776818 16:1599433-1599455 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1133833968 16:9350590-9350612 CGCCCCGACTGGGAAGTGAGGGG - Intergenic
1134082779 16:11335969-11335991 CGCCCCGACCGGGAGGGAGGTGG - Intronic
1135335775 16:21599847-21599869 CGGCCCGGGTGGGCCGGCGGCGG + Exonic
1136258831 16:29060258-29060280 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1136668615 16:31836658-31836680 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1136932511 16:34432078-34432100 CACACCGTCTGGGCAGGCTGAGG - Intergenic
1136972061 16:34979736-34979758 CACACCGTCTGGGCAGGCTGAGG + Intergenic
1137261190 16:46831217-46831239 CGCGGGGACTGGGCGGGCGGAGG - Exonic
1137522984 16:49210343-49210365 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1138043543 16:53698521-53698543 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1138043637 16:53698745-53698767 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1138179746 16:54933240-54933262 CTCCCCGGCTGGGCCAGCGGCGG + Exonic
1138642529 16:58396899-58396921 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
1140994158 16:80243480-80243502 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1142011822 16:87719075-87719097 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1142151237 16:88513414-88513436 AGCCCCGATTGGGCAGGCTGTGG - Intronic
1142186070 16:88695295-88695317 GGCCCTGTCTGGGCAGGCCGTGG - Intergenic
1142409890 16:89910684-89910706 CGCACCCACTGGGGAGGCAGGGG - Intronic
1142939818 17:3371836-3371858 CGCCCCGTCCGGGCGGGAGGTGG - Intergenic
1143884834 17:10057608-10057630 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1144481987 17:15637182-15637204 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1145733845 17:27212666-27212688 CGCCCCGTCCGGGAGGGCGGAGG + Intergenic
1146444222 17:32922391-32922413 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG + Exonic
1147261018 17:39209905-39209927 TGACGCGGCTGGGCAGGCGGAGG + Intergenic
1147351084 17:39844704-39844726 CGCTTGAACTGGGCAGGCGGAGG - Intronic
1147909491 17:43847064-43847086 CTCCCCGGCTGGGCCTGCGGAGG + Intergenic
1147963382 17:44180664-44180686 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1147974483 17:44238894-44238916 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1148632853 17:49125682-49125704 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1148636083 17:49150275-49150297 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1148786829 17:50149723-50149745 TCCCCCGACGGGGCGGGCGGCGG + Exonic
1148936486 17:51167269-51167291 GGACCCGAGTGGGCAGGCGCAGG - Intronic
1149625016 17:58074222-58074244 CGCCCCGACCGGGAGGGAGGTGG - Intergenic
1149908913 17:60551485-60551507 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1149908935 17:60551534-60551556 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1150527437 17:65937772-65937794 CGCCCCGTCTGGGAGGGGGGTGG + Intronic
1150561909 17:66302299-66302321 CGGCCCGAGTGGGGATGCGGGGG - Intergenic
1151843775 17:76636676-76636698 CGCCCCGTCTGGGAGGTCGGGGG + Intronic
1152696097 17:81797785-81797807 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1152809988 17:82376820-82376842 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1153286984 18:3465628-3465650 CGCCTGGACTTGGGAGGCGGAGG + Intergenic
1153636389 18:7117268-7117290 TGCCCCGGCTGCGCGGGCGGGGG - Intronic
1154278353 18:12980253-12980275 CGCCCCGACCGGGAGGGAGGTGG - Intronic
1154398145 18:14010596-14010618 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1156326252 18:36077624-36077646 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1157455903 18:47828208-47828230 CGCCCCGTCTGGGAGGGAGGTGG + Exonic
1157620839 18:49016770-49016792 CTCCCTGTCTGGGCAGGCGTAGG - Intergenic
1157677203 18:49577672-49577694 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1157677348 18:49577997-49578019 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1160992971 19:1868198-1868220 AGCCCACACTGGGCAGGGGGTGG - Intergenic
1161327782 19:3671733-3671755 CCCACCCCCTGGGCAGGCGGTGG - Intronic
1161345923 19:3768658-3768680 CGGCCTCCCTGGGCAGGCGGGGG + Intergenic
1162255203 19:9483608-9483630 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1162328116 19:10010538-10010560 AGCCCCGCCTGGCCAGGCGCTGG - Intergenic
1162886899 19:13703461-13703483 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1163556967 19:17998541-17998563 CGCCCAGACTGCCCAGGCAGAGG + Exonic
1163558465 19:18005727-18005749 CGCCCCGTCTGGGAGGGAGGCGG - Intronic
1163945220 19:20529821-20529843 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1164066837 19:21722068-21722090 CGCCCCGTCCGGGAGGGCGGTGG + Intergenic
1164106020 19:22107699-22107721 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1164192183 19:22926352-22926374 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1164192406 19:22926853-22926875 CGCCCCGTCCGGGAAGGAGGTGG + Intergenic
1164298456 19:23937243-23937265 CGCCCCGGCTGGGAGGGAGGTGG - Intronic
1164658579 19:29942485-29942507 CGCGCCGCCTGCGCAGGCGCTGG + Exonic
1165104814 19:33462486-33462508 CGCCACGGCTGGGCAGCCGCCGG + Intronic
1165192933 19:34079420-34079442 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1165192979 19:34079519-34079541 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1165493620 19:36139880-36139902 CGCCCTGACTCGGTAGGCGGGGG - Exonic
1166030099 19:40118747-40118769 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1166162840 19:40965973-40965995 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1166162968 19:40966275-40966297 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1166191841 19:41180813-41180835 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1166832727 19:45648246-45648268 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1167499297 19:49836352-49836374 GGCCAGGACTGGGCAGGTGGTGG - Exonic
1167703437 19:51064899-51064921 GGCCCCGAGTGGGCGGGGGGCGG + Intronic
1167907804 19:52676527-52676549 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1167970624 19:53186808-53186830 CGGGGCGACTGGCCAGGCGGGGG + Intronic
1167970722 19:53187028-53187050 CGGGGCGACTGGCCAGGCGGGGG + Intronic
1168335212 19:55593402-55593424 GGCCCCGAGGGGGCAGGCGCGGG - Exonic
925361865 2:3285380-3285402 CGCTGCAGCTGGGCAGGCGGTGG - Intronic
926215337 2:10902637-10902659 CGCCCCGACCGGGAGGGAGGTGG - Intergenic
927776860 2:25910355-25910377 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
927833055 2:26370497-26370519 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
927833106 2:26370623-26370645 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
928005284 2:27557742-27557764 CGGGGCGACTGGCCAGGCGGGGG + Intronic
929447856 2:42014742-42014764 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
929577738 2:43063156-43063178 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
929614579 2:43297560-43297582 CGGCACGGCTGGCCAGGCGGGGG - Intronic
929650795 2:43677937-43677959 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
929690148 2:44067161-44067183 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
929690172 2:44067211-44067233 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
929739898 2:44589113-44589135 CGCCCCGTCTGGGAGGGTGGTGG + Intronic
930059255 2:47274717-47274739 CTCCCCAAGTGGGCAGGCTGGGG + Intergenic
930202045 2:48556579-48556601 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
931479989 2:62630521-62630543 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
931783567 2:65600740-65600762 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
932710759 2:74061477-74061499 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
932807494 2:74796131-74796153 CGCCCCGACCGGGAGGGAGGTGG - Intergenic
933684613 2:85133425-85133447 CGCCCCGGCGGAGCAGGCGGCGG + Exonic
933772605 2:85753829-85753851 GGCCCGGGCTGGGGAGGCGGTGG + Intronic
933910314 2:86934919-86934941 CGCCCGAACTCGGGAGGCGGAGG - Intronic
934022413 2:87968490-87968512 CGCCCGAACTCGGGAGGCGGAGG + Intergenic
934654168 2:96108728-96108750 CTCTCCGGCAGGGCAGGCGGGGG - Intergenic
934753037 2:96806138-96806160 CGCCCCGTCCGGGAGGGCGGTGG - Intronic
936413876 2:112286519-112286541 CGCCCGAACTCGGGAGGCGGAGG - Intronic
936504729 2:113096499-113096521 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
936546181 2:113394461-113394483 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
936546473 2:113395133-113395155 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
936546497 2:113395182-113395204 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
937168465 2:119843760-119843782 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
937919530 2:127119909-127119931 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
938253422 2:129833674-129833696 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
938534126 2:132221896-132221918 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
938588603 2:132715833-132715855 TGCACCTGCTGGGCAGGCGGGGG + Intronic
938828935 2:135033584-135033606 CGCCCCGTCTGGGAGGGCGGTGG - Intronic
939584723 2:143991666-143991688 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
939584768 2:143991763-143991785 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
940299197 2:152160630-152160652 CGCCCCGTCCGGGAGGGCGGTGG + Intronic
940299272 2:152160804-152160826 CGCCCCGTCCGGGAAGGTGGTGG + Intronic
940652304 2:156451528-156451550 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
941603114 2:167563914-167563936 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
941768864 2:169327292-169327314 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
941768935 2:169327465-169327487 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
941847915 2:170150260-170150282 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
941917601 2:170822647-170822669 CGACCCGACTGCGCGGGTGGAGG - Intronic
942630230 2:177945839-177945861 CGGCACGGCTGGCCAGGCGGGGG - Intronic
942630654 2:177946764-177946786 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
942630757 2:177946991-177947013 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
943297090 2:186153970-186153992 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
943411905 2:187557139-187557161 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
943739757 2:191397831-191397853 CGCCCCGTCTGGGAGGGTGGTGG - Intronic
944598327 2:201282575-201282597 CGCCCCGTCCGGGAGGGCGGTGG - Intronic
944831182 2:203535183-203535205 CGCCGCGCCTGGGGAGGAGGCGG - Exonic
945114917 2:206400875-206400897 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
945233108 2:207610980-207611002 CGGGGCGACTGGCCAGGCGGGGG - Exonic
945316611 2:208377506-208377528 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
946706256 2:222461425-222461447 CCCACGGACTGGGCAGGTGGGGG + Intronic
947402392 2:229743040-229743062 CGCCCCGTCTGGGAGGGAGGCGG + Intergenic
947402460 2:229743186-229743208 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
947797954 2:232906196-232906218 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
1169086183 20:2825097-2825119 CGCCCCGTCCGGGAGGGCGGTGG + Intergenic
1169345188 20:4823442-4823464 CAGCCAGGCTGGGCAGGCGGTGG + Intronic
1170202576 20:13760690-13760712 CGCCCCGTCTGGGAGGGAGGCGG + Intronic
1170470185 20:16661018-16661040 TGCCCAGGCTGGGCAGGCAGTGG + Intergenic
1170623122 20:18010662-18010684 CGCCCCGACCGGGAGGGAGGTGG - Intronic
1171499795 20:25585053-25585075 GGCCCGCGCTGGGCAGGCGGCGG + Intronic
1171944078 20:31360396-31360418 CGCTTCAACTGGGGAGGCGGAGG + Intergenic
1172118071 20:32583559-32583581 CGGCCCGACCGGGCCGGGGGCGG + Intronic
1172209142 20:33185250-33185272 CGCCCCGACAGGGAGGGAGGTGG - Intergenic
1172257978 20:33536309-33536331 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1172279347 20:33699388-33699410 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1172280022 20:33701673-33701695 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1172349592 20:34230025-34230047 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1172458028 20:35092862-35092884 CGCCCCCAGTGGGCCGTCGGCGG + Exonic
1172819424 20:37718471-37718493 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1172902312 20:38344157-38344179 CTCCCCTCCTGGGCAGGCTGAGG + Intergenic
1172918390 20:38461332-38461354 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1173517824 20:43677660-43677682 CGCCCCGACTGGGAGGGAGGTGG + Intronic
1174020566 20:47525772-47525794 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1175993630 20:62802384-62802406 CGCCCTGGGTGGGCAGGCGGGGG - Intergenic
1176348336 21:5770770-5770792 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1176355150 21:5891354-5891376 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1176496491 21:7553685-7553707 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1176542657 21:8168840-8168862 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1176561608 21:8351885-8351907 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1177178260 21:17720047-17720069 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1177178490 21:17720564-17720586 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1179574703 21:42300706-42300728 CAACCCAACTGGCCAGGCGGGGG + Intergenic
1179646340 21:42778532-42778554 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1179646363 21:42778580-42778602 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1179885906 21:44314216-44314238 TGCCCCCAGTGGGCAGGAGGCGG + Intronic
1179969351 21:44825291-44825313 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1180039598 21:45269016-45269038 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1180039649 21:45269143-45269165 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1180861411 22:19084788-19084810 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
1181586230 22:23854886-23854908 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1181586392 22:23855243-23855265 CGGGGCGACTGGCCAGGCGGGGG - Intergenic
1181981927 22:26772838-26772860 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1182555019 22:31124512-31124534 TGCCCCGAATGGGCAGGGTGTGG + Intronic
1182616274 22:31591915-31591937 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1183606850 22:38871339-38871361 GGCCCCAGCTGGGCAGGGGGTGG - Intronic
1183845291 22:40537075-40537097 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1183871380 22:40744792-40744814 CGCCCCGTCCGGGAGGGCGGTGG - Intergenic
1184145519 22:42607916-42607938 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1203247522 22_KI270733v1_random:85083-85105 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
949959621 3:9301346-9301368 CCACCCATCTGGGCAGGCGGGGG - Intronic
950162667 3:10772030-10772052 CTCCCCGACTGGGCAGGGTCGGG + Intergenic
950253662 3:11487616-11487638 CGGCACGGCTGGCCAGGCGGGGG + Intronic
951013465 3:17705076-17705098 CGGCACGGCTGGCCAGGCGGGGG + Intronic
951013510 3:17705173-17705195 CGGCACGGCTGGCCAGGCGGGGG + Intronic
951013532 3:17705222-17705244 CGGCACGGCTGGCCAGGCGGGGG + Intronic
951013554 3:17705271-17705293 CGGCACGGCTGGCCAGGCGGGGG + Intronic
952308909 3:32169908-32169930 CGCCCCGTCCGGGAAGGGGGGGG + Intergenic
952896498 3:38081819-38081841 CGGCACGGCTGGCCAGGCGGGGG + Intronic
952934872 3:38389538-38389560 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
953855153 3:46494811-46494833 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
953855206 3:46494939-46494961 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
953959529 3:47256498-47256520 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
953966332 3:47309873-47309895 CGCCTGCACTGGGCAGGCTGAGG + Intronic
954059387 3:48056225-48056247 CGGCACGGCTGGCCAGGCGGGGG - Intronic
954162817 3:48734490-48734512 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
955268067 3:57467156-57467178 TGCCCAGACTGGGCATGCAGAGG + Intronic
955297425 3:57747643-57747665 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
955297612 3:57748063-57748085 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
956270415 3:67444072-67444094 CGGCGCGGCTGGCCAGGCGGGGG - Intronic
956270437 3:67444121-67444143 CGGCACGGCTGGCCAGGCGGGGG - Intronic
956270521 3:67444314-67444336 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
956270671 3:67444667-67444689 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
959042691 3:101439510-101439532 CGGCACGGCTGGCCAGGCGGGGG - Intronic
959085603 3:101849013-101849035 CGCCGCGCCGGGGCAGGCAGAGG + Intronic
959415312 3:106073973-106073995 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
959415409 3:106074196-106074218 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
959663568 3:108896473-108896495 CCCCCCTACTGGGGAGGCTGAGG + Intergenic
960780337 3:121313099-121313121 CGCCCCGTCTGGGAGGGTGGTGG - Intronic
961163817 3:124750398-124750420 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
962572285 3:136723762-136723784 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
964765966 3:160178841-160178863 CGCCCCGTCCGGGAAGGAGGTGG + Intergenic
966015115 3:175131879-175131901 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
966015393 3:175132570-175132592 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
966359632 3:179120129-179120151 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
966359654 3:179120178-179120200 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
966359975 3:179120903-179120925 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
966420110 3:179727983-179728005 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
967169358 3:186811640-186811662 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
968156577 3:196385775-196385797 CGCCCCGTCTGGGAAGTGGGGGG + Intronic
968213399 3:196868024-196868046 TGCCGCGACGGGGCCGGCGGCGG + Exonic
968514860 4:1011736-1011758 GTCCCGGACCGGGCAGGCGGCGG - Intronic
968924322 4:3539015-3539037 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
970472670 4:16393388-16393410 CGCCCCGACCGGGAGGGAGGTGG - Intergenic
972552608 4:40147642-40147664 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
972552630 4:40147689-40147711 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
972552783 4:40148333-40148355 CGCAGGCACTGGGCAGGCGGAGG + Intronic
973281445 4:48363900-48363922 CGGCACGGCTGGCCAGGCGGGGG + Intronic
973317816 4:48779982-48780004 CGCCCAGGCTGGGCTGCCGGCGG + Intronic
973593502 4:52465116-52465138 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
973675171 4:53255978-53256000 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
974549201 4:63349496-63349518 CACCCCGACTGGGGCGGCTGGGG + Intergenic
975685783 4:76917331-76917353 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG + Intronic
977633815 4:99272612-99272634 CGCTCCAACTTGGGAGGCGGAGG - Intergenic
980056411 4:128083582-128083604 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
982182812 4:152765260-152765282 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
982615906 4:157637108-157637130 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
982709628 4:158746521-158746543 CGCCCCGTCCGGGCGGGAGGTGG - Intergenic
983940255 4:173529463-173529485 GGGCCCGGCTGGCCAGGCGGGGG - Exonic
984037939 4:174692295-174692317 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
984533453 4:180944836-180944858 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
985520992 5:373834-373856 CGCCCTGCCCGGGCGGGCGGGGG + Intronic
988240076 5:28597053-28597075 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
989379743 5:40800624-40800646 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
989379845 5:40800877-40800899 CGCCCCGTCTGGGAGGGTGGTGG + Intergenic
989379945 5:40801131-40801153 CGCCCCGTCTGGGAGGGTGGTGG + Intergenic
990426916 5:55696533-55696555 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
991073613 5:62513321-62513343 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
991373319 5:65940496-65940518 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
992289860 5:75270922-75270944 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
992373909 5:76171722-76171744 CGGCACGGCTGGCCAGGCGGGGG - Intronic
992463629 5:76984757-76984779 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
992470025 5:77043560-77043582 CGGCACGGCTGGCCAGGCGGGGG + Intronic
992852477 5:80824402-80824424 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
993162875 5:84312618-84312640 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
993657557 5:90595221-90595243 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
993657658 5:90595446-90595468 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
995462731 5:112419952-112419974 CGCCCCAGCTGGGAACGCGGCGG + Intergenic
995942275 5:117599792-117599814 CGCCCCGACCGGGAGGGAGGTGG - Intergenic
996069916 5:119122146-119122168 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
996386238 5:122913307-122913329 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
997874743 5:137537761-137537783 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
997874871 5:137538067-137538089 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
997874890 5:137538116-137538138 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1000032997 5:157419844-157419866 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1000033041 5:157419939-157419961 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1002013701 5:176305153-176305175 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1002013792 5:176305368-176305390 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1002045063 5:176536987-176537009 CGGCCAAACTGGGCAGGGGGCGG + Exonic
1002205480 5:177560105-177560127 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1002541208 5:179907649-179907671 CGCCGCGGCTGGGCTGGCGGCGG - Intronic
1003324969 6:5084671-5084693 CGCCGCCACTGGGCAGATGGGGG + Exonic
1004414857 6:15415604-15415626 CGCCCCGACCGGGAGGGAGGTGG - Intronic
1004414908 6:15415703-15415725 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
1004874491 6:19939821-19939843 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1005837601 6:29719616-29719638 CGCCCCGTCCGGGAGGGCGGTGG + Intergenic
1006039801 6:31244235-31244257 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1006064680 6:31454738-31454760 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1006064974 6:31455426-31455448 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1006148935 6:31976047-31976069 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1006231971 6:32595052-32595074 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1006232307 6:32595784-32595806 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1006346294 6:33485745-33485767 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1006546748 6:34786845-34786867 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1006625125 6:35392418-35392440 TTCCCAGTCTGGGCAGGCGGAGG - Intronic
1007403169 6:41616420-41616442 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1007674250 6:43580917-43580939 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1007785234 6:44276027-44276049 CGCTGCGGCGGGGCAGGCGGCGG + Exonic
1008624616 6:53305114-53305136 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1008926200 6:56894237-56894259 CGCCCCGTCCGGGAGGGCGGTGG - Intronic
1010030403 6:71266400-71266422 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1010264370 6:73851065-73851087 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1010300603 6:74255113-74255135 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1011114660 6:83876947-83876969 CTCCCAGACTGGGGAGGCTGAGG - Intronic
1011148572 6:84244671-84244693 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1011297374 6:85839039-85839061 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1011601605 6:89065128-89065150 CGCCCCGCCTGGCCAGGGGCAGG - Intergenic
1014763815 6:125388326-125388348 CGCCCCGTCCGGGAGGGCGGTGG - Intergenic
1014947497 6:127515676-127515698 CGCCGCCATTGGGGAGGCGGAGG + Exonic
1016386745 6:143537029-143537051 CGATCCGGCCGGGCAGGCGGCGG + Intronic
1017215079 6:151899359-151899381 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
1017843980 6:158240772-158240794 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1019445809 7:1070318-1070340 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1019458780 7:1146340-1146362 CGGGGCGACTGGCCAGGCGGGGG + Intergenic
1019458879 7:1146559-1146581 CGGGGCGACTGGCCAGGCGGGGG + Intergenic
1019981408 7:4624256-4624278 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1020284632 7:6670959-6670981 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1020284726 7:6671185-6671207 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1020325956 7:6975222-6975244 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1020616344 7:10465616-10465638 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1020831807 7:13102978-13103000 CGCCCCGACCGGGAGGGAGGTGG + Intergenic
1021647471 7:22801202-22801224 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1021672279 7:23046111-23046133 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1021735449 7:23637006-23637028 CGCCCCGTCCGGGAAGGGGGAGG + Intronic
1022005482 7:26262280-26262302 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1024538878 7:50460164-50460186 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
1024625875 7:51208366-51208388 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1024931185 7:54667739-54667761 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1025103190 7:56151306-56151328 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1025795831 7:64738427-64738449 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1025800887 7:64785029-64785051 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1025800908 7:64785077-64785099 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1025821376 7:64967673-64967695 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1025821450 7:64967849-64967871 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1026783359 7:73284298-73284320 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1027233029 7:76282891-76282913 CGGGCCGACGGGGCGGGCGGCGG + Intronic
1027371150 7:77509390-77509412 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1027371260 7:77509631-77509653 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1027371309 7:77509758-77509780 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1028685440 7:93585844-93585866 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1029112242 7:98218247-98218269 CGCCCCGAGTGTGCAGAAGGCGG - Intronic
1029114926 7:98231952-98231974 CACACCGACTGCGCAGGCCGGGG + Exonic
1029425919 7:100493926-100493948 CGCCTGGACTGGGGAGGGGGCGG + Exonic
1029429956 7:100523387-100523409 CGCCCCGTCCGGGAAGGAGGCGG - Intergenic
1030602858 7:111610288-111610310 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1031886724 7:127252225-127252247 CGCTCTGACTGGGCGTGCGGCGG - Intronic
1032042879 7:128576972-128576994 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1032042930 7:128577099-128577121 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1032291323 7:130591580-130591602 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
1032569619 7:132985005-132985027 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1032569768 7:132985355-132985377 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
1032793546 7:135259769-135259791 CGCACCGAGTGGGCAGAGGGAGG + Intergenic
1033376187 7:140763472-140763494 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
1034322553 7:150198767-150198789 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1034343133 7:150370415-150370437 GGCACAGTCTGGGCAGGCGGTGG + Intronic
1034352654 7:150427529-150427551 CTCCCTGACGGGGCAGGAGGAGG - Intergenic
1034638659 7:152585991-152586013 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1034723448 7:153315137-153315159 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1035312705 7:157979896-157979918 GCCCCCGACTGGGCAGCTGGGGG + Intronic
1035611995 8:973210-973232 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1036536539 8:9657308-9657330 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG + Intronic
1039153327 8:34529224-34529246 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1039650827 8:39339069-39339091 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1040069730 8:43179638-43179660 CGGGGCGACTGGCCAGGCGGGGG + Intronic
1040069817 8:43179847-43179869 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1041070810 8:54125471-54125493 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1041677257 8:60548778-60548800 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1041796377 8:61752613-61752635 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1041796592 8:61753105-61753127 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1042049019 8:64685887-64685909 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1042226756 8:66520419-66520441 GGCCCCGAGTGGGAAGGAGGAGG - Intergenic
1043958509 8:86389840-86389862 CGCCCCATCTGGGAAGGAGGTGG - Intronic
1043985840 8:86694086-86694108 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1044660672 8:94590916-94590938 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1044847903 8:96399669-96399691 AGCCCTGATTGGGCAGGGGGTGG + Intergenic
1045443774 8:102239501-102239523 CGCCCGGAGTGGGCGAGCGGAGG - Intergenic
1047206589 8:122807157-122807179 GGCTCCTACTGGGCAGGCGCAGG + Intronic
1047687268 8:127316443-127316465 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1048368552 8:133758070-133758092 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1051661808 9:19433793-19433815 CGCCCCGTCCGGGAAGGAGGTGG - Intronic
1053255779 9:36615223-36615245 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1053255800 9:36615272-36615294 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1053255869 9:36615419-36615441 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1054722112 9:68614644-68614666 CGCCAGGACTGGGCTGGAGGTGG - Intergenic
1055414265 9:76064385-76064407 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1055506674 9:76955624-76955646 CGCCCCGTCCGGGAAGGAGGTGG + Intergenic
1056229129 9:84526742-84526764 CGCCCCGTCTGGGAAGTGGGGGG - Intergenic
1056229143 9:84526779-84526801 CGCCCCGTCTGGGAAGTGGGGGG - Intergenic
1056564223 9:87758669-87758691 CGGGGCGACTGGCCAGGCGGGGG + Intergenic
1057042424 9:91857315-91857337 TGACCTCACTGGGCAGGCGGTGG + Intronic
1059120876 9:111640963-111640985 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1059211068 9:112514412-112514434 CGGCACGGCTGGCCAGGCGGGGG - Intronic
1060687230 9:125624011-125624033 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1060687352 9:125624314-125624336 CGCCCCGTCCGGGAAGGAGGTGG + Intronic
1060703700 9:125780373-125780395 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1060703727 9:125780425-125780447 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1061299642 9:129697342-129697364 CGCCCCGGCCGGGCGGGAGGGGG - Intronic
1061326827 9:129869259-129869281 CGCCCCGGCCAGGCAGGTGGAGG + Intronic
1061400502 9:130365736-130365758 CTCCCAGGCTGGGCAGGGGGAGG + Intronic
1061982972 9:134116224-134116246 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1061983597 9:134117683-134117705 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1061983909 9:134118404-134118426 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1062033439 9:134372271-134372293 CGCGCCCACTGGGGAGGTGGAGG + Intronic
1062129169 9:134883462-134883484 AGCCCTGCCTGGGCAGGCGTTGG - Intronic
1062532518 9:137008118-137008140 CCCCCAGACTCGGCAGACGGAGG - Intronic
1062543995 9:137053700-137053722 CTCCCCGACCGGGTACGCGGAGG - Intronic
1203463928 Un_GL000220v1:68318-68340 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1203405597 Un_KI270539v1:401-423 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1203562698 Un_KI270744v1:71750-71772 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1187183664 X:16965275-16965297 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1187184206 X:16968656-16968678 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1187976336 X:24709026-24709048 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1187976447 X:24709268-24709290 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1187976514 X:24709415-24709437 CGGCACGGCTGGCCAGGCGGGGG + Intronic
1188367587 X:29333591-29333613 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1188477154 X:30602463-30602485 CGGCACGGCTGGCCAGGCGGGGG - Intergenic
1188477265 X:30602703-30602725 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1189056803 X:37707268-37707290 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1189210355 X:39278016-39278038 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1189210428 X:39278191-39278213 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1189391880 X:40583326-40583348 AGCCCAGACTGGGGAGGCTGAGG + Intronic
1189569990 X:42285721-42285743 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1189837601 X:45040407-45040429 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1189955860 X:46275647-46275669 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1189968359 X:46395620-46395642 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1189968453 X:46395845-46395867 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1190114892 X:47619934-47619956 CGGTCCGGCTGGGCCGGCGGCGG + Intergenic
1190521183 X:51280275-51280297 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1190779181 X:53578783-53578805 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1191010048 X:55749038-55749060 CGCCCCGTCTGGGAGGGAGGTGG + Intronic
1191068962 X:56380251-56380273 CGCCCCGTCTGGGAGGGAGGTGG - Intergenic
1191618120 X:63189672-63189694 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1191618142 X:63189721-63189743 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1192463949 X:71341443-71341465 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1192476950 X:71452119-71452141 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1192768816 X:74167209-74167231 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1192768864 X:74167307-74167329 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1192885677 X:75334759-75334781 CGCCCCGTCTGGGAAGTGGGGGG - Intergenic
1193068103 X:77279559-77279581 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1193345175 X:80396912-80396934 CGCCCCGTCTGGGAGGGAGGTGG - Intronic
1193362306 X:80591453-80591475 CGCCCCGTCTGGGAGGGAGGTGG + Intergenic
1195625093 X:106999527-106999549 GGCCCCGGCTCCGCAGGCGGAGG - Intronic
1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG + Intronic
1196404366 X:115347467-115347489 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1196404387 X:115347516-115347538 CGGCACGGCTGGCCAGGCGGGGG + Intergenic
1197335165 X:125203691-125203713 CGCCCCGAGGCTGCAGGCGGCGG - Intergenic
1197736015 X:129850804-129850826 CGCCCCGTCTGGGAAGGAGGTGG + Intergenic
1198051458 X:132956673-132956695 CACCCCGGCTGGGCAGGTGCTGG - Intronic
1198476250 X:137000166-137000188 CGCCCCGTCCGGGAAGGAGGTGG - Intergenic
1200092459 X:153642347-153642369 TGCCCCTCCTGGGCAGGGGGCGG + Intergenic