ID: 1146787627

View in Genome Browser
Species Human (GRCh38)
Location 17:35732736-35732758
Sequence GTGGCAGCTCAGAGATTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146787627_1146787633 6 Left 1146787627 17:35732736-35732758 CCTAGAAATCTCTGAGCTGCCAC 0: 1
1: 0
2: 2
3: 18
4: 199
Right 1146787633 17:35732765-35732787 AGAGAGGCCAGGACTCTTCTTGG 0: 1
1: 0
2: 0
3: 34
4: 258
1146787627_1146787628 -10 Left 1146787627 17:35732736-35732758 CCTAGAAATCTCTGAGCTGCCAC 0: 1
1: 0
2: 2
3: 18
4: 199
Right 1146787628 17:35732749-35732771 GAGCTGCCACACCCAGAGAGAGG 0: 1
1: 0
2: 1
3: 36
4: 292
1146787627_1146787629 -5 Left 1146787627 17:35732736-35732758 CCTAGAAATCTCTGAGCTGCCAC 0: 1
1: 0
2: 2
3: 18
4: 199
Right 1146787629 17:35732754-35732776 GCCACACCCAGAGAGAGGCCAGG 0: 1
1: 0
2: 1
3: 46
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146787627 Original CRISPR GTGGCAGCTCAGAGATTTCT AGG (reversed) Intronic
900724070 1:4203521-4203543 GTAACATCTCAGAGATTTCTTGG - Intergenic
901954165 1:12771896-12771918 GTGGCATCTCAGAGCTGTTTGGG + Intergenic
902191500 1:14766358-14766380 GGGGCAGCTCAGTGAGTGCTTGG - Intronic
905263782 1:36737497-36737519 GTGGAAGCTGAGGGACTTCTAGG - Intergenic
908639576 1:66206787-66206809 GTGGAAGTTCAGAGATTGCATGG + Intronic
910065295 1:83144021-83144043 GTTGCAGCTCTGCGTTTTCTTGG - Intergenic
910323594 1:85977362-85977384 CTGGCAATTCAGAGATTTCTTGG - Intronic
911071789 1:93837603-93837625 GTTGCAGCTCTGAGACTGCTGGG + Intronic
920079386 1:203361266-203361288 GTGGAGGCTCAGAGATGTGTGGG + Intergenic
922029308 1:221782672-221782694 GTGGCCTCTCAGAGGTTTCCTGG - Intergenic
922780709 1:228250234-228250256 GTGGCAGGTCAGTGCTTTGTGGG + Exonic
923210527 1:231800022-231800044 CAGCCAGGTCAGAGATTTCTGGG - Intronic
1063100573 10:2946222-2946244 GTGTCTGCTCAGAGATGTGTGGG - Intergenic
1063307896 10:4922679-4922701 GGGGTAGCACAGTGATTTCTAGG + Intronic
1063320810 10:5051554-5051576 GGGGTAGCACAGTGATTTCTAGG - Intronic
1066646629 10:37617393-37617415 TTGGCAGCTCAGAGACATCGGGG - Intergenic
1067965100 10:50903250-50903272 GTTGCAGATCAGAGAGTTATAGG - Intergenic
1070791888 10:79194597-79194619 TTGGCAGCCCAGAGATATCCAGG + Intronic
1071303274 10:84273875-84273897 TTCGCAGCTCAGAGAAGTCTGGG + Intergenic
1072616521 10:97052986-97053008 GGGGCAGCTAAGTAATTTCTTGG + Intronic
1075194912 10:120348087-120348109 GGGGCAGCTAAGAGAGTGCTTGG + Intergenic
1075222905 10:120600358-120600380 GAGCCAGCTGAGAGCTTTCTAGG + Intergenic
1076510706 10:131012018-131012040 GGGGCCACTCAGAGATTCCTGGG + Intergenic
1077580311 11:3413269-3413291 GTGGGAGCTCAGGGGTTGCTTGG + Intergenic
1077979003 11:7279812-7279834 GAGGAAGATCAGAAATTTCTGGG - Intronic
1078367263 11:10717009-10717031 GTGTCTGCTCAGGGACTTCTGGG + Intergenic
1079335659 11:19568253-19568275 TTGGGGGCTCAGAGATCTCTAGG + Intronic
1079634017 11:22712692-22712714 CTGGCATTTCAGAAATTTCTTGG - Intronic
1081121852 11:39276474-39276496 CTGGTAGCCCAGACATTTCTTGG + Intergenic
1081753779 11:45530645-45530667 GTGGAAACTCAGAGATGTCAAGG + Intergenic
1084753991 11:71223055-71223077 GAGGGAGCTCAGAGATTTGGAGG + Intronic
1086222898 11:84471248-84471270 CTGACAGCTCAGAGATTACAAGG + Intronic
1088428842 11:109734740-109734762 GTGACAGCTCAAGGATTGCTGGG + Intergenic
1089023305 11:115241044-115241066 GTGTCAGTTCAGAGATGCCTGGG - Intronic
1091084962 11:132712674-132712696 GCGGCAGCTCAGAGATGAATTGG - Intronic
1092161344 12:6317063-6317085 GAGGGAGCTCAGAGAGCTCTGGG + Intronic
1093753910 12:22831250-22831272 GGGGCAGGTCAGAGATTCCCTGG + Intergenic
1096204041 12:49706895-49706917 GCGGCTGCTCAGAGGTTCCTGGG + Intronic
1099843372 12:87995967-87995989 GTGGCAGAACAGAGATTATTTGG - Intronic
1100935825 12:99664727-99664749 GTGGCAGAAAAAAGATTTCTGGG - Intronic
1101221792 12:102649224-102649246 GTGGCAGAACTGAGATTCCTAGG + Intergenic
1103964006 12:124626538-124626560 GTTCCAGCTCAGAAATCTCTGGG + Intergenic
1104891030 12:132140270-132140292 GGGGCAGCTCAGGCCTTTCTGGG + Intronic
1106301267 13:28468492-28468514 ATGGAAGGTCAGAGATTTCAAGG - Intronic
1108035648 13:46288011-46288033 GTGGCAGATCAGTATTTTCTAGG + Intergenic
1111702945 13:91713616-91713638 GCTGGTGCTCAGAGATTTCTTGG - Intronic
1115098643 14:29671105-29671127 TAGGCAGCTCAGAAGTTTCTGGG + Intronic
1115342696 14:32309070-32309092 GTAGGAGATCAGAGATTTCTGGG - Intergenic
1116494014 14:45538578-45538600 GAGGGAGCTCAGAGATTTAAGGG - Intergenic
1117236204 14:53779372-53779394 GTGACTGCCAAGAGATTTCTGGG + Intergenic
1117339740 14:54783032-54783054 GTGGCAACACGGAGACTTCTCGG + Intronic
1117480186 14:56135483-56135505 ATGGTAGCTCAGAGATTTTGAGG + Intronic
1117963209 14:61182312-61182334 GTGGCAGATCAAAGCTTTGTTGG + Intergenic
1118265319 14:64289114-64289136 GTGGCAGCTCAGGGAGTTTGTGG - Intronic
1118728601 14:68650589-68650611 TTGGCTGCTTAGACATTTCTTGG - Intronic
1119121705 14:72085462-72085484 GTCCCAGCCCAGAGATTTGTTGG + Intronic
1122276134 14:100591745-100591767 GTTGTAGCTCAGAACTTTCTGGG - Intergenic
1122280342 14:100618522-100618544 CTGGCTGCCCAGAGCTTTCTGGG + Intergenic
1122832164 14:104403804-104403826 GTGGCAGCTCAGAACTTCCGTGG + Intergenic
1202901946 14_GL000194v1_random:49377-49399 ATGGCAGCTCAGAAGTGTCTGGG + Intergenic
1124391446 15:29262396-29262418 CTGTCTGCTCAGAGTTTTCTTGG - Intronic
1125702678 15:41701717-41701739 GTGGCAGCTAATAGTTTTTTGGG + Intronic
1125894846 15:43293693-43293715 GTGGCTTCTCAGTCATTTCTGGG + Intronic
1127005736 15:54567606-54567628 GTGTCATTTCAGAGATGTCTAGG + Intronic
1129674019 15:77622671-77622693 GTGCCTGCTCAGAGATAACTGGG + Intronic
1130155229 15:81344690-81344712 GTGACAGCTCAGAGAGTTGCTGG + Intronic
1133842103 16:9419299-9419321 ATGGCAGCTCAGTTATTTTTAGG - Intergenic
1134835402 16:17356659-17356681 ATGACAGCTCAGCGATTTCAAGG - Intronic
1136143083 16:28299607-28299629 GGGGAAGCTTAGAGGTTTCTCGG - Intronic
1139002446 16:62529153-62529175 AAAGCAGCTCAGACATTTCTTGG + Intergenic
1142033557 16:87850348-87850370 GGGGCAGCTCACAGCTTGCTGGG + Intronic
1143151689 17:4810850-4810872 GTGCCAGCTCAGTGATCTCTTGG - Exonic
1144044908 17:11446696-11446718 GTGGCTGGTCAGAGATATCTGGG - Intronic
1144944016 17:18960642-18960664 GGGGCAGCTCACCGATATCTTGG - Exonic
1146787627 17:35732736-35732758 GTGGCAGCTCAGAGATTTCTAGG - Intronic
1148744211 17:49909490-49909512 CTGGCAGCTCAGACAGTTCCTGG + Intergenic
1150527873 17:65942447-65942469 TTGGCAGCTCAAAGATGTCAGGG + Intronic
1151436632 17:74101674-74101696 GGGGCAGTTCAGAGCTTGCTAGG + Intergenic
1203165868 17_GL000205v2_random:94889-94911 GTGACAGCTTAGGGTTTTCTGGG - Intergenic
1153014231 18:568892-568914 ATGGCTGCTCAGATATTTCCAGG - Intergenic
1153828879 18:8901832-8901854 CTGGCAATTCAGAGACTTCTTGG - Intergenic
1155677632 18:28448800-28448822 ATGGAAATTCAGAGATTTCTTGG - Intergenic
1156231189 18:35155456-35155478 TTGGGAGCACAGATATTTCTTGG + Intergenic
1156418993 18:36930132-36930154 GTGACAGTTTAGACATTTCTGGG - Intronic
1156485412 18:37462483-37462505 CTGGCAGCTCAGAGATCTCAGGG - Intronic
1157195526 18:45617506-45617528 GGGGTGGCTCAGAGTTTTCTTGG - Intronic
1157531594 18:48425730-48425752 GAGGCAGCACAGGGACTTCTGGG - Intergenic
1157855356 18:51100231-51100253 GTGGCAGGTCAGAGTGGTCTTGG - Intergenic
1158699580 18:59734200-59734222 AAGGCAGCTCAAAGGTTTCTTGG - Intergenic
1158742683 18:60161917-60161939 CTGGCAGCTCAGACATGACTTGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1165104799 19:33462429-33462451 GTGGCAGCACACTGACTTCTGGG + Intronic
1167371596 19:49085778-49085800 GTGGGTGCCCAGAGATTTCGGGG - Intronic
924979291 2:206711-206733 GTGGCTTTTCAGTGATTTCTGGG - Intergenic
926555904 2:14357679-14357701 GTGGCAGCTCTGAGTTAGCTGGG - Intergenic
927055047 2:19359346-19359368 GTGAAATCTCAGAGAGTTCTGGG - Intergenic
928590732 2:32812062-32812084 GTCACAGGTCAGAGAATTCTGGG - Intronic
928651451 2:33407984-33408006 GTGGGAGCACAGGGATTTGTAGG - Intergenic
928782626 2:34843298-34843320 GTTGCAGCTCAGAGTTTCTTTGG - Intergenic
929439804 2:41956467-41956489 GTGGCTGCTCTGAGGTTTCTGGG - Intergenic
929462232 2:42111027-42111049 GTGGCAACTAAGAGATGCCTGGG - Intergenic
929652876 2:43699776-43699798 GTGGCATCTCCCAGAATTCTGGG + Exonic
930358323 2:50347229-50347251 GTGGCTGCTCCCAGATTTCCAGG + Intronic
934504743 2:94881057-94881079 ATGGCAGCTCAGAAGTGTCTGGG - Intergenic
934520897 2:95019594-95019616 GTGCCAACTCAGAGACATCTGGG + Intergenic
938207613 2:129437579-129437601 GTGGCAGCTTAGGCACTTCTGGG + Intergenic
940133025 2:150405760-150405782 CTGCCAGCTTAGAGGTTTCTGGG + Intergenic
944690857 2:202157230-202157252 GTGGTAGCTCCCAGATTCCTGGG + Intronic
945949246 2:216023214-216023236 GTGGCAGCACAGAGGATTATAGG - Intronic
946631726 2:221676908-221676930 GTAGAAGCTCAGTGATTTCACGG + Intergenic
948156830 2:235790301-235790323 TTGGCAGCACACAGAATTCTAGG - Intronic
948732079 2:239971934-239971956 GTCTCAGCTATGAGATTTCTTGG + Intronic
1169800878 20:9510062-9510084 GTGCCATCTCAGAGATTTTGAGG + Intergenic
1171947136 20:31388741-31388763 GTGGGAGCTGAGAGATTTAAAGG - Intronic
1172046128 20:32081655-32081677 GTGGCAGCTCAGTGAATGCCTGG + Intronic
1173466093 20:43282560-43282582 AAGGCAGCTCAGAAATGTCTGGG + Intergenic
1173596996 20:44264916-44264938 GAGGCAGCTCATAGATGTCATGG + Intronic
1173600702 20:44292966-44292988 TGGGCAGCTGACAGATTTCTGGG - Intergenic
1174255044 20:49248326-49248348 GTGGCAGATCCGGCATTTCTTGG + Exonic
1175390214 20:58622328-58622350 GTGGCAGCTCTGATGTTCCTGGG + Intergenic
1176405886 21:6364198-6364220 GTGACAGCTTAGGGTTTTCTGGG + Intergenic
1176621315 21:9064144-9064166 ATGGCAGCTCAGAAGTGTCTGGG + Intergenic
1177030088 21:15971932-15971954 CTAGCAGCTCACAGTTTTCTAGG - Intergenic
1177912427 21:27049425-27049447 GTGGCAGGTCAGAGTGGTCTTGG - Intergenic
1179890984 21:44334997-44335019 CTGGCAGCTCAGAAGTCTCTAGG - Intronic
1180912927 22:19465583-19465605 GAGGTAGCTGAGAGGTTTCTGGG + Intronic
1182945778 22:34319967-34319989 ATGGCTGCTCCTAGATTTCTGGG + Intergenic
1183309936 22:37103903-37103925 GTGCCAGCTCAGGGGATTCTGGG - Intronic
1184294884 22:43516977-43516999 TTGGCAGCTCTGAGATGGCTTGG - Intergenic
1184493543 22:44824277-44824299 GTGGCTCCCCAGAGATGTCTCGG - Intronic
1185004504 22:48267814-48267836 GGGGCTGCTCAGAGCTTTGTAGG + Intergenic
950886258 3:16365631-16365653 GTGGCAGCAGAGAGACATCTGGG + Intronic
953048286 3:39315654-39315676 ATGTGACCTCAGAGATTTCTAGG + Intergenic
955806607 3:62742477-62742499 GTGGAAGATCAGATATTTGTAGG - Intronic
956992959 3:74790033-74790055 GTGCCATCTCAAAGATTTTTAGG + Intergenic
957125701 3:76157318-76157340 GGGGCACCTAAGAGATTTGTGGG + Intronic
958502621 3:94934572-94934594 GTAGCAACCCAAAGATTTCTGGG - Intergenic
960497840 3:118396652-118396674 TTGGCAGCTCAAAGATTTCTTGG - Intergenic
960640361 3:119817252-119817274 GTGGCGGCTCAGAGGGCTCTGGG - Exonic
962604722 3:137023823-137023845 GTGGGGGCTCAGAGACTGCTGGG + Intergenic
964492022 3:157247166-157247188 GTGGAAGTTCAGAGGTTTCTGGG - Intergenic
965764909 3:172120141-172120163 ATGGCAGCTCTGAGCTGTCTGGG + Intronic
965994531 3:174863753-174863775 GTGGCATCACAAAGATTTCAAGG - Intronic
967251388 3:187543951-187543973 GTGACAGCTCAGAATTTTCTTGG - Intergenic
968894424 4:3390332-3390354 GTGGCAGGTCAGAGTTGTCCCGG + Intronic
973891339 4:55370296-55370318 ATGGCAGATCTGCGATTTCTGGG + Exonic
976548549 4:86366680-86366702 GTGGCAGTAAGGAGATTTCTGGG + Intronic
981177628 4:141701111-141701133 CTGGCATTTCAGAGATTTCTTGG + Intronic
981331592 4:143515081-143515103 GTCGGAGCCCAAAGATTTCTGGG + Intronic
984705739 4:182845914-182845936 CTGGCAGCCCAGACCTTTCTTGG + Intergenic
988535637 5:32065476-32065498 GTGCCATATCCGAGATTTCTTGG + Intronic
989716462 5:44468647-44468669 CTGACAGCTCAGATATTTGTGGG + Intergenic
993001283 5:82383493-82383515 GTGGTAGCTCACAGATGTTTTGG - Intronic
993218488 5:85058553-85058575 AGGGCAGCTCACAGATTTGTTGG - Intergenic
994347326 5:98701649-98701671 CTGGCAATTCAGAGGTTTCTTGG - Intergenic
995418972 5:111941092-111941114 TTGGTAACCCAGAGATTTCTGGG - Intronic
998231455 5:140363770-140363792 GTGGTACCCCAGCGATTTCTTGG + Exonic
998353465 5:141515839-141515861 GTGGCAGGTTACAGAGTTCTGGG - Exonic
998415380 5:141942305-141942327 GAGGCAGCTCAGAGATTGACAGG - Intergenic
998964541 5:147524988-147525010 GTGTCAGATAAGAGATTTGTAGG + Intergenic
1001029539 5:168251899-168251921 GTAGGAGCTCAGAGACATCTGGG + Intronic
1002698149 5:181103916-181103938 GTGGCGGCACAGACATCTCTCGG + Intergenic
1002709081 5:181183334-181183356 GTGGCGGCACAGACATCTCTCGG - Intergenic
1002821702 6:731478-731500 GTGGCAGCACAGAGATTCCTTGG + Intergenic
1005600622 6:27423136-27423158 TAAGCAGCTCGGAGATTTCTGGG - Intergenic
1007076811 6:39073605-39073627 GCGGCAGCTCAGAGAGTCCTGGG - Exonic
1007308083 6:40922829-40922851 GTGGCACCTCAAATCTTTCTTGG + Intergenic
1007537427 6:42605454-42605476 CTGGGAGCTCAGAGAACTCTTGG - Intronic
1008317284 6:50059970-50059992 GTGGAAGCTTAAAGATTTTTAGG - Intergenic
1010535158 6:77017824-77017846 GGGACAGCTGACAGATTTCTGGG - Intergenic
1012008694 6:93752219-93752241 GAGGAATCTCAGAGTTTTCTTGG - Intergenic
1012973554 6:105756225-105756247 GAGGCAGCTCAGAGATTCAGAGG + Intergenic
1016055872 6:139577304-139577326 GTGGAAGCACAGAGCATTCTGGG + Intergenic
1016684195 6:146863110-146863132 GAGGGAGCTCAGTGTTTTCTGGG - Intergenic
1018103187 6:160459246-160459268 GTGCCAGCTCAGAGGGCTCTGGG - Intergenic
1018111156 6:160538045-160538067 GTGCCAGCTCAGAGGGCTCTGGG - Intronic
1018739878 6:166719951-166719973 GTGGCAGCTTTGAGATATGTGGG + Intronic
1019001545 6:168757625-168757647 GTAGCATCTCAGAGACTTCTGGG + Intergenic
1019634330 7:2067418-2067440 CTGGAAGCTCAGAGCTTCCTGGG - Intronic
1024229448 7:47353127-47353149 CTGCCAGCTCAGAGAGCTCTTGG + Intronic
1024460830 7:49657668-49657690 CTGGCAGCAAAGAGACTTCTGGG + Intergenic
1027278812 7:76590726-76590748 GTTGCAGCTCTGCGTTTTCTTGG + Intergenic
1030794479 7:113770595-113770617 GTGGCAGGTCAGAGTGGTCTTGG + Intergenic
1031985890 7:128164516-128164538 GTGGCAGCACAGACACTACTGGG + Intergenic
1039888658 8:41669984-41670006 GTGCCAGCTGAGAGACTTCAAGG - Intronic
1040470449 8:47731843-47731865 GTGGCAGATCTGAGTTTTCAGGG + Intronic
1040869319 8:52083938-52083960 GTGGCTGCTCACAGATTTGCAGG + Intergenic
1041605674 8:59780021-59780043 GTGGCATCTCAGAAATTTGTGGG + Intergenic
1042646811 8:70996361-70996383 GTGGCAATTGATAGATTTCTAGG + Intergenic
1044371264 8:91413737-91413759 GAGGCAGCTCAGGGAATTCTGGG + Intergenic
1046032207 8:108796539-108796561 GTTGCATTTAAGAGATTTCTAGG + Intergenic
1046487796 8:114909421-114909443 GTGGCAGCTCTGCGATTTTCTGG + Intergenic
1046925938 8:119788618-119788640 GAGGAAGTACAGAGATTTCTGGG - Intronic
1047835824 8:128689387-128689409 GTGGCAGGTCAGAGTGGTCTTGG + Intergenic
1049749440 8:144276386-144276408 GGAGCTGCTCAGAGATTTCGGGG - Intronic
1053425048 9:38004909-38004931 CTGGGAGCTGAGAGATTTGTGGG + Intronic
1054315354 9:63578083-63578105 GTGTAAGCTCTGTGATTTCTTGG + Intergenic
1055519940 9:77070706-77070728 AGGGCAGCTGAGAGATTTCCTGG + Intergenic
1057056336 9:91964119-91964141 GTGGCAGCTTAGGGGCTTCTCGG + Intergenic
1057125078 9:92610592-92610614 GTGGAATCTCACAGATTTCTAGG - Intronic
1057420898 9:94911394-94911416 GTGGCTGCTCTGAGAAATCTGGG - Intronic
1059286457 9:113176647-113176669 GTGCTTGCTCAGAGGTTTCTTGG + Exonic
1061314439 9:129785960-129785982 ATGGCAGCTCCCAGATTTCTTGG - Intergenic
1061353547 9:130085574-130085596 GTGACAGATCAGTGATTGCTTGG - Intronic
1185623720 X:1468637-1468659 GTGGCTGTCCAGAAATTTCTGGG + Intronic
1186858911 X:13652264-13652286 GGGGCAGCTCAGAGCTGTCAGGG - Intergenic
1186930868 X:14388522-14388544 GTGGTAGCTCACATATTTATTGG + Intergenic
1188719135 X:33500968-33500990 CTGGCAATTCAGAGATTTCTTGG - Intergenic
1191864858 X:65695751-65695773 GTGCCAGCTCATAGATTTGGGGG - Intronic
1193191643 X:78578441-78578463 GGGGCAGCTAAGAGAGTGCTGGG + Intergenic
1193311333 X:80014125-80014147 GTGTCAGCCAAGACATTTCTGGG + Intergenic
1193590732 X:83385453-83385475 CTGGCAATTCAGAGATTTCTTGG - Intergenic
1193626030 X:83820935-83820957 CTGGTATTTCAGAGATTTCTTGG + Intergenic
1193794946 X:85862781-85862803 GTGGCAGGTCACAGATTCATGGG - Exonic
1194089626 X:89568647-89568669 AAGGCAGCTCAGAGATTACCTGG - Intergenic
1195121840 X:101762301-101762323 GAGGCTGCTCAGGGTTTTCTAGG + Intergenic
1198966572 X:142233458-142233480 GTGGCTGCTCAGAGGTCTATTGG - Intergenic
1200442280 Y:3224700-3224722 AAGGCAGCTCAGAGATTACCTGG - Intergenic
1202178412 Y:22118749-22118771 GTTGCAGCACTGTGATTTCTAGG - Intergenic
1202212949 Y:22467645-22467667 GTTGCAGCACTGTGATTTCTAGG + Intergenic