ID: 1146790580

View in Genome Browser
Species Human (GRCh38)
Location 17:35748420-35748442
Sequence TACTGCCTCAGGTCTAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146790574_1146790580 -3 Left 1146790574 17:35748400-35748422 CCCTATCTGCATCACAGGGCTAC 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1146790580 17:35748420-35748442 TACTGCCTCAGGTCTAGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 119
1146790575_1146790580 -4 Left 1146790575 17:35748401-35748423 CCTATCTGCATCACAGGGCTACT 0: 1
1: 0
2: 2
3: 13
4: 133
Right 1146790580 17:35748420-35748442 TACTGCCTCAGGTCTAGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 119
1146790570_1146790580 11 Left 1146790570 17:35748386-35748408 CCACAGGTTCTTGCCCCTATCTG 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1146790580 17:35748420-35748442 TACTGCCTCAGGTCTAGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 119
1146790573_1146790580 -2 Left 1146790573 17:35748399-35748421 CCCCTATCTGCATCACAGGGCTA 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1146790580 17:35748420-35748442 TACTGCCTCAGGTCTAGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 119
1146790568_1146790580 30 Left 1146790568 17:35748367-35748389 CCTGTGTTGGGAAGTGGGGCCAC 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1146790580 17:35748420-35748442 TACTGCCTCAGGTCTAGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146790580 Original CRISPR TACTGCCTCAGGTCTAGGGG AGG Intronic
900339155 1:2179696-2179718 TTCTGCCTCAGGGCCAGGAGTGG + Intronic
902176670 1:14655767-14655789 TGCTGCTACGGGTCTAGGGGTGG + Intronic
903569468 1:24293778-24293800 CACTGCCCCAGGGCCAGGGGTGG + Intergenic
904314630 1:29652239-29652261 TCCTGCCACAGCTCTAGGGCAGG + Intergenic
904384544 1:30132740-30132762 TCCTGCCACAGCTCTAGGGCAGG - Intergenic
905270275 1:36783066-36783088 TAGAGTCTAAGGTCTAGGGGTGG - Intergenic
907379083 1:54070611-54070633 TACAACCTCAGGTTTAGGGGAGG - Intronic
908863703 1:68521103-68521125 TAATGCCACAGGTCAAGGGAGGG - Intergenic
910633182 1:89378455-89378477 TACTCCATCAGGCCTTGGGGAGG - Exonic
910799464 1:91131170-91131192 CACTCCCTCATGGCTAGGGGAGG - Intergenic
912643868 1:111372600-111372622 TACTGCCTCAGGTTGAGGGAGGG - Intergenic
916004296 1:160645715-160645737 TACTTCCCAAGGTCTAGGGGAGG - Intronic
916202239 1:162283334-162283356 TATAGCCTCAGGTTTAGGGCTGG + Intronic
920118975 1:203641376-203641398 TTTTTCATCAGGTCTAGGGGTGG + Intronic
1065069561 10:22008573-22008595 TACTGCCACAGTTCAAGGTGTGG + Intergenic
1066497367 10:35955266-35955288 TATTGCCCCAGGTGTAGAGGGGG - Intergenic
1067655621 10:48189304-48189326 CACTGCCTCAGGTGAAGGTGTGG - Intronic
1069897320 10:71687721-71687743 TACAGGCTCAGGTCGGGGGGTGG + Intronic
1076816303 10:132916606-132916628 TGCTGGCTCAGGTCTTCGGGGGG + Exonic
1077610216 11:3639316-3639338 GACTGCTTCAGGTCTCAGGGGGG - Intronic
1079367772 11:19824289-19824311 TACAGTCTCAGGTGTAGGTGTGG - Intronic
1081106624 11:39078583-39078605 GACTCCCTCTGCTCTAGGGGAGG + Intergenic
1084325868 11:68399755-68399777 ACCTGCCCCAGGTCTGGGGGAGG + Intronic
1085506883 11:77066107-77066129 TGCTGCCTCAGGGCGGGGGGTGG + Intergenic
1089096985 11:115927446-115927468 TCCCGCCTCAGGCCTTGGGGAGG + Intergenic
1090856292 11:130611807-130611829 TACTGCCTGAGGGCTAGAGCAGG - Intergenic
1096492170 12:52018903-52018925 CAGGGGCTCAGGTCTAGGGGAGG + Intergenic
1098313875 12:69174022-69174044 TCCTGCCTCAGTTCCAGGAGTGG - Intergenic
1100449968 12:94696241-94696263 TCCCTCCTCAGGTCTAGGGCTGG + Intergenic
1102534464 12:113570173-113570195 TGCTGCCTCAGGCCTCGGGCAGG + Intergenic
1105968618 13:25406841-25406863 TAATGCCTCAGCTCAAGCGGTGG + Intronic
1114339471 14:21727889-21727911 CACTTGCTCAGGTCTAAGGGTGG + Intergenic
1114851669 14:26389838-26389860 GACTGCCTTAGGTCATGGGGTGG + Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1122278918 14:100609973-100609995 TCCTGCCCCAGGGCTGGGGGAGG + Intergenic
1127155828 15:56123518-56123540 TGCTGCCTCAGGTTGAGGGAAGG + Intronic
1129938947 15:79477300-79477322 TTCTGATTCAGGTCTAGGGTGGG - Intergenic
1130873337 15:87990283-87990305 CACTGCTTCAAGTCTTGGGGTGG - Intronic
1131335539 15:91545259-91545281 TACTGACTCAGGACTAGGTTAGG + Intergenic
1133415750 16:5605698-5605720 GTCTACCTCAGGTCTAGGAGGGG + Intergenic
1134290742 16:12901659-12901681 TACTGCGAGAGGGCTAGGGGCGG + Exonic
1135119584 16:19754045-19754067 GATTGGCTCAGGTCTAGGTGGGG + Intronic
1139959524 16:70709744-70709766 TACTGCCTGAGGTCCAGGCTGGG + Intronic
1140106010 16:71960917-71960939 AACTGTATCAGGTCTAGGGAGGG + Intronic
1142054330 16:87983249-87983271 CACTCCTTCAGGTCTAGGGAGGG - Intronic
1146422344 17:32699470-32699492 TGCTGTCTCAGCTCTGGGGGTGG + Intronic
1146790580 17:35748420-35748442 TACTGCCTCAGGTCTAGGGGAGG + Intronic
1151878338 17:76880075-76880097 TGCTGCTTCAGCTCTTGGGGTGG + Intronic
1152427412 17:80225740-80225762 CACTGTCTCAGCCCTAGGGGAGG + Intronic
1152553806 17:81043153-81043175 CACTGCATCCGGTCTAGGTGGGG + Intronic
1155184991 18:23379803-23379825 TGCTGCCAAAGGGCTAGGGGTGG + Intronic
1155256012 18:23999012-23999034 GACTGCCTCAGGTCTCTGTGTGG + Intronic
1156038250 18:32790213-32790235 TTCTGACTCAGGTCTGGGGTGGG - Intergenic
1160579201 18:79874034-79874056 TACAGCCTCAGGTCAAGCGTGGG + Intronic
1161264433 19:3357898-3357920 TCCTGCCTCAGGTTTGCGGGAGG + Intergenic
1161685106 19:5698649-5698671 TGATGCCCCAGGACTAGGGGTGG - Intronic
1162124938 19:8494363-8494385 TTCTGCTTCCGCTCTAGGGGAGG - Intronic
1167133116 19:47600537-47600559 TATTGGCCCAGGTCTGGGGGCGG - Intergenic
1168127448 19:54293761-54293783 TGTAGCCTCATGTCTAGGGGTGG + Intergenic
925251910 2:2446120-2446142 TGCTCCCTCGGGTCCAGGGGTGG - Intergenic
926038234 2:9652008-9652030 TTGTCCCTCAGGACTAGGGGTGG + Intergenic
929744435 2:44641448-44641470 TACTGCCTTAGGTCTGGGGTTGG - Intronic
930196439 2:48515667-48515689 TAGTGCCTCGGGAGTAGGGGTGG - Intergenic
932686543 2:73875526-73875548 TTCTCCCTCAGTACTAGGGGAGG + Intergenic
932721155 2:74139783-74139805 TTCTGGCTCAGGACTTGGGGGGG - Intronic
934752389 2:96801296-96801318 TGCTGCCTCAGCTCTAGAAGGGG + Intronic
934969073 2:98748633-98748655 TCCTGCCTCAGATCTCGGGAAGG + Intergenic
940619816 2:156097430-156097452 AACTGCCTCAAGTCCAGGTGGGG - Intergenic
943791228 2:191934617-191934639 TTCTTCCTCAGTCCTAGGGGTGG - Intergenic
944486622 2:200213563-200213585 TGCCCCTTCAGGTCTAGGGGTGG - Intergenic
947501519 2:230674642-230674664 TGCTGCCAAAGGTCTAAGGGTGG - Intergenic
1170606912 20:17881711-17881733 TCCTGCCTCAGGGCTCAGGGAGG - Intergenic
1172070392 20:32252425-32252447 TCCTGTCTCAGGTCTGGGGGTGG - Intergenic
1172528850 20:35617183-35617205 TCCTGCCTCAGATCCAGGGTCGG - Exonic
1176309371 21:5141696-5141718 TCCTGCCTCAGGTCAAGGTGTGG - Exonic
1178862289 21:36299501-36299523 TACTTCCTCAGGTACAGGGAGGG + Intergenic
1179847691 21:44120337-44120359 TCCTGCCTCAGGTCAAGGTGTGG + Exonic
1180782683 22:18529705-18529727 TACCGCCCCAGGTCTGGGGGAGG - Exonic
1181126243 22:20703732-20703754 TACCGCCCCAGGTCTGGGGGAGG - Intergenic
1181239573 22:21469043-21469065 TACCGCCCCAGGTCTGGGGGAGG - Intergenic
949934633 3:9107216-9107238 TACTGTGTCAGGTCTTGGGTGGG + Intronic
955027046 3:55178264-55178286 TACTGCCACAGTTTTAGGGATGG - Intergenic
956024850 3:64972241-64972263 CACTGGCTCAGGTCCTGGGGAGG + Intergenic
957577844 3:82032250-82032272 TACTCCCTCAAGTCTATGGGTGG + Intergenic
959584297 3:108011875-108011897 TACTACCTCTGTGCTAGGGGTGG - Intergenic
959611192 3:108296406-108296428 TACTGACTCAGATCTGGGTGGGG + Intergenic
963845191 3:150148190-150148212 GACTGCCTAAGGGCTAGGAGAGG + Intergenic
966358295 3:179105971-179105993 TACTGCTGAAAGTCTAGGGGAGG - Intergenic
967580588 3:191148505-191148527 TACTGCCTCAGGTCTGTTTGGGG + Intergenic
968184359 3:196621721-196621743 TACTTCCCTAGGTCTGGGGGAGG - Intergenic
968958969 4:3733263-3733285 TGCTGCTTCAGGTCTAGGGCTGG + Intergenic
974341756 4:60622867-60622889 TAATGCCTCAGGTCTACAGTGGG - Intergenic
974413885 4:61579123-61579145 TATTATCTCAGGTCTAGGAGTGG - Intronic
981542671 4:145861748-145861770 GACTGCTTCAGGACTAGGGCAGG - Intronic
984419816 4:179506877-179506899 TACTGTCTCAGGGCTAGCAGAGG + Intergenic
990061411 5:51653915-51653937 TACTGGGTCATGACTAGGGGCGG - Intergenic
996321503 5:122222351-122222373 TACTGCCTCAGTTATAGTGCTGG - Intergenic
997480889 5:134183810-134183832 GACTGCCTTGGGTCTAGGGTAGG + Intronic
1001740972 5:174052395-174052417 CACAGCCTCAGGTCTAGCTGGGG - Intronic
1005219053 6:23565057-23565079 TATAGCCTCAGGCCAAGGGGTGG - Intergenic
1006299290 6:33185295-33185317 TGCTGCCTCTGGTCCTGGGGCGG + Intronic
1011735717 6:90309022-90309044 GCATGGCTCAGGTCTAGGGGAGG + Intergenic
1012985936 6:105876469-105876491 AACAGCCTCAAGTCTAGAGGTGG + Intergenic
1014298146 6:119646410-119646432 TGCCACCTCAGCTCTAGGGGTGG - Intergenic
1019277505 7:183440-183462 TACGGCCTCAGGTGTGGAGGAGG - Intergenic
1019426872 7:982162-982184 TACAGCCTCAGGGCCAGGGCTGG - Intergenic
1019526207 7:1481623-1481645 CACTGCCCCAGGTCTTGGGTGGG - Intronic
1019526229 7:1481695-1481717 CACTGCCCCAGGTCTTGGGTGGG - Intronic
1019526239 7:1481731-1481753 CACTGCCCCAGGTCTCGGGTGGG - Intronic
1021650058 7:22824117-22824139 TACTGCCTCAGTTCCTGGGTCGG + Intergenic
1028426237 7:90692674-90692696 TCCTGCCCCAGGACTAGGGGAGG + Intronic
1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG + Intronic
1038333627 8:26628988-26629010 TACTGCCTCGGGTGCAGGAGGGG + Intronic
1038508432 8:28106838-28106860 TACTGACTAAGGGCTAGAGGGGG - Intronic
1039249799 8:35650340-35650362 AACTGCTTCAGGGCTAAGGGAGG - Intronic
1042582234 8:70292438-70292460 TCCTGCCTCAGGGCTGGGTGCGG - Intronic
1045246388 8:100445107-100445129 TCCTGCCTGAGCTCTAGGGGAGG + Intergenic
1050266322 9:3893876-3893898 GACTGGCTCAGGACTAGAGGTGG + Intronic
1053616023 9:39766699-39766721 TCCTACCTCAGGGCTAGAGGAGG - Intergenic
1053874196 9:42526009-42526031 TCCTACCTCAGGGCTAGAGGAGG - Intergenic
1053898424 9:42768576-42768598 TCCTACCTCAGGGCTAGAGGAGG + Intergenic
1054237494 9:62575691-62575713 TCCTACCTCAGGGCTAGAGGAGG + Intergenic
1054268137 9:62940745-62940767 TCCTACCTCAGGGCTAGAGGAGG + Intergenic
1054551630 9:66610202-66610224 TCCTACCTCAGGGCTAGAGGAGG + Intergenic
1056804390 9:89717622-89717644 TACTGCCACAGGTATGGGGAAGG - Intergenic
1058155860 9:101513963-101513985 GACTGTCTCAGCTCTAGGAGAGG + Intronic
1059423754 9:114208145-114208167 TACTTCCTCAGGGCTGGGCGCGG + Intronic
1062279808 9:135746894-135746916 TGATGGCTCTGGTCTAGGGGAGG + Intronic
1186837288 X:13450428-13450450 TACTGCCTCAGGTTGAGGGCTGG - Intergenic
1188030438 X:25257620-25257642 GACTGCCTCACATCTAGGGGTGG - Intergenic
1188572169 X:31600854-31600876 AACGGCTTCAGGTCTAGGAGAGG + Intronic
1188746247 X:33847693-33847715 TACTGACTCTGGTTTAGGGATGG + Intergenic
1194882730 X:99273864-99273886 TACTGCCTGGGGTCAAGGGAGGG - Intergenic
1195864156 X:109411327-109411349 TACTGCCTGAGGCCTGTGGGTGG - Intronic
1197685479 X:129435422-129435444 TTCTGCTTCAGGGCTAGGGTTGG - Intergenic
1199485024 X:148338092-148338114 CACTGCCTGAGGGCTGGGGGAGG - Intergenic