ID: 1146791010

View in Genome Browser
Species Human (GRCh38)
Location 17:35750483-35750505
Sequence CCCCCTAGGAGGGGTCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146791010 Original CRISPR CCCCCTAGGAGGGGTCTGGG CGG Intronic
900997458 1:6130168-6130190 CCCCCTGGGAGGGTGGTGGGCGG + Intronic
901404825 1:9038977-9038999 CCCCATTGGAGGGGGCTGGAGGG - Intronic
901854770 1:12037697-12037719 TCGCCTGGGAGGGGTGTGGGAGG - Intergenic
901880727 1:12192340-12192362 AGCCCTAGGAGAGGTCTGAGGGG - Intronic
901917507 1:12511281-12511303 CCACCTAGGGCGGGGCTGGGTGG + Exonic
903664143 1:24996379-24996401 ACCACTAGGAGGAGGCTGGGGGG - Intergenic
904239472 1:29134571-29134593 ACCCCTGGGAGCGGTCGGGGTGG + Intergenic
905138978 1:35825730-35825752 CCCTCTGGGAGGGGGCAGGGAGG + Exonic
905363482 1:37435999-37436021 TCCCGTAGGAGGTGCCTGGGAGG - Intergenic
905648281 1:39639699-39639721 CCCCCGAGGCGGGGCCGGGGCGG - Exonic
907436143 1:54449545-54449567 GCTCAGAGGAGGGGTCTGGGTGG - Intergenic
908477640 1:64505546-64505568 CCCCAGAGGAGGGGGCGGGGCGG - Intronic
911122613 1:94311141-94311163 CTCTCTTGGAGAGGTCTGGGAGG + Intergenic
912572905 1:110637593-110637615 GCCCCTGGGTGGGGCCTGGGTGG + Intergenic
915545741 1:156596475-156596497 CCATCTAGGAGGGGTCATGGGGG + Exonic
920229242 1:204459777-204459799 AGCACTATGAGGGGTCTGGGTGG - Intronic
920453048 1:206074855-206074877 TCACCTATGAGGGGGCTGGGAGG - Intronic
923147595 1:231209113-231209135 CCCCGAAGGCGGGGTCTGGGTGG - Exonic
1063973656 10:11398264-11398286 CTGCCTGGGAGGGATCTGGGAGG + Intergenic
1064031710 10:11887056-11887078 CCCCGCAGGAGGGGTCTGAGGGG + Intergenic
1067163875 10:43849332-43849354 CCCCTTAGGAGGCATCTAGGTGG + Intergenic
1070707555 10:78651688-78651710 CCCCATTAGAGGAGTCTGGGAGG + Intergenic
1072808934 10:98445044-98445066 ACCCCTTGGTGGGGGCTGGGAGG + Intronic
1074456758 10:113602290-113602312 CCACCTGGGAGAGGTATGGGAGG - Intronic
1075083169 10:119397257-119397279 GCCCCGAGGTGGGGTCGGGGTGG - Intronic
1075651790 10:124132181-124132203 CCCCCCAGGAAGGTTCTAGGAGG - Intergenic
1076206950 10:128611280-128611302 CCCCCCAGGAGGTGTCCAGGTGG + Intergenic
1076719377 10:132386601-132386623 CTTCCAAGCAGGGGTCTGGGTGG - Intergenic
1076786362 10:132751879-132751901 GTGCCTAGGAGGTGTCTGGGTGG + Intronic
1077217868 11:1402571-1402593 CCCCCCAGGAGGAGTCAGGAGGG - Intronic
1077384739 11:2263554-2263576 ACCCCTCAGAGGGGGCTGGGAGG + Intergenic
1078552508 11:12290253-12290275 CCCCCTAGCAGGGGTGGGAGTGG + Intronic
1081858022 11:46316210-46316232 CCCCCTAGGAGAGCTCCAGGAGG + Intronic
1083674130 11:64316118-64316140 CCCCCTAGGAGGGGGAGGAGAGG - Exonic
1083882432 11:65555179-65555201 AAGCCAAGGAGGGGTCTGGGTGG - Intronic
1084009116 11:66338009-66338031 CCACTCAGGAGGGGTCAGGGAGG - Intronic
1084672676 11:70616461-70616483 CGCCCGAGGAGGGCGCTGGGTGG + Intronic
1087713665 11:101583202-101583224 CCTCCTAGGACGGTGCTGGGAGG - Intronic
1090398803 11:126435519-126435541 ACGTCTCGGAGGGGTCTGGGAGG + Intronic
1092246625 12:6867690-6867712 TCGCCGAGGAGGGGTCTGGCCGG + Intronic
1096071020 12:48775615-48775637 CACCCTGGGATGGGGCTGGGGGG - Intronic
1096183535 12:49564378-49564400 GGCCCCAGGAGGGGTCTGGGAGG - Intronic
1100395836 12:94185706-94185728 GCCCCTGGCAGGGGTGTGGGAGG + Intronic
1100550493 12:95642567-95642589 CCCTATAGAAGAGGTCTGGGTGG - Intergenic
1103566750 12:121819909-121819931 CCCCCTGGGAGGGTGGTGGGAGG + Intronic
1103699825 12:122843232-122843254 CCGCCTGGGAGGGGCCTGAGGGG + Intronic
1112929305 13:104714387-104714409 CCCCCTCGCAGGGGTGTGGCTGG - Intergenic
1112962741 13:105147569-105147591 CCACCAAGGAGGAGGCTGGGAGG + Intergenic
1113417074 13:110136837-110136859 CCCCCTCAGATGGGTGTGGGGGG + Intergenic
1117831906 14:59759889-59759911 CACACTAGGAGGAGGCTGGGAGG + Intronic
1121231018 14:92358533-92358555 CCCAGGAGGAGGTGTCTGGGAGG - Intronic
1123056576 14:105573837-105573859 CCCCCAAGGCGGGGTGTGGTGGG - Intergenic
1123081635 14:105697948-105697970 CCCCCAAGGCGGGGTGTGGTGGG + Intergenic
1123439519 15:20280626-20280648 CCTCCTGGGACGGGGCTGGGAGG + Intergenic
1124605976 15:31170670-31170692 CCCCCTGGGAGGTGTGTTGGTGG - Intergenic
1125899410 15:43330897-43330919 CCGCCAAGGAAGGGTCTGGTAGG + Intronic
1127797934 15:62454401-62454423 ACCCATTGGAGGGGTCTGGTTGG + Intronic
1128212267 15:65910946-65910968 CCCCCAAGGACAGGTCTGAGAGG - Intronic
1129333851 15:74840998-74841020 CCACATAGGAGGGGTGTGGTGGG - Intronic
1129390111 15:75216111-75216133 CCCCCTATGAGTGGTGTGAGGGG - Intergenic
1131062155 15:89410828-89410850 ACCCCTTGGAGGGGTTAGGGAGG + Intergenic
1131459163 15:92606421-92606443 CCCCCAAAGAGGTGTCTGAGGGG + Intergenic
1131461766 15:92622593-92622615 CCCCCGAGGAGGGGCTTGGGGGG + Intronic
1132270626 15:100520764-100520786 CCCACTAGGAGTGGGCAGGGTGG + Intronic
1132339116 15:101066898-101066920 GCCCCTAGGAGCTGTCTGAGGGG - Intronic
1132537885 16:492380-492402 CTCCCGGGGAGGGCTCTGGGCGG - Intronic
1132630307 16:914158-914180 CCTCCTAGGAGGGGTCGGGGTGG - Intronic
1132830985 16:1928211-1928233 CCCCACAGCAGGGGCCTGGGTGG - Intergenic
1132844644 16:1994349-1994371 CCCCACAGGAGGGGACGGGGAGG + Intergenic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1133239997 16:4408540-4408562 TGCCCTAGGAGGGGTCGGGCTGG - Intronic
1134596429 16:15499665-15499687 CCCTCTAGGAAGGAACTGGGAGG - Intronic
1136070131 16:27782567-27782589 CCCCCTTGGCAGGCTCTGGGGGG - Intergenic
1137537141 16:49336045-49336067 CCCCACAGAAGGGATCTGGGTGG - Intergenic
1137578783 16:49621103-49621125 CCCCCTCCGAGGACTCTGGGAGG - Intronic
1137719248 16:50618374-50618396 CCCCCTTGGTGTGGCCTGGGTGG + Intronic
1140395930 16:74626852-74626874 TCCCCTAGCAGAGGTCTGGCAGG - Intronic
1140959376 16:79897466-79897488 GCCCCCAGAAGGGGTATGGGTGG - Intergenic
1141518472 16:84562069-84562091 CCACCTGGGCAGGGTCTGGGAGG - Intergenic
1141560875 16:84867072-84867094 CCCCTTTGGAGGTGGCTGGGAGG - Intronic
1142319440 16:89371633-89371655 CACCCAAGGAGGGGTGTGGAGGG + Intronic
1143315303 17:6027599-6027621 CCCCCAGGGATTGGTCTGGGTGG - Intronic
1143325645 17:6096467-6096489 CTCCCTTGGAGGGGGCTGGAGGG + Intronic
1144574405 17:16419939-16419961 TCCCCTAGGATGGCTCTAGGAGG + Intronic
1146791010 17:35750483-35750505 CCCCCTAGGAGGGGTCTGGGCGG + Intronic
1147969845 17:44213346-44213368 CCAGCGAGGAGGGGTCTGGGTGG - Intronic
1148086825 17:44998636-44998658 GCCTTTAGGAGGGGTCAGGGAGG + Intergenic
1148641656 17:49192473-49192495 CAAGCTAGGAGGGCTCTGGGCGG - Intergenic
1150389831 17:64783841-64783863 CCCCCAGGGAGGGGTGGGGGTGG + Intergenic
1151048357 17:70948021-70948043 CCGCCTAGAAACGGTCTGGGGGG + Intergenic
1151304233 17:73252792-73252814 CTCCCTAGGAAGGGTGTGGATGG + Intronic
1151753252 17:76054343-76054365 CCCCATAGTAGGGGTGTGGTTGG - Intronic
1152470311 17:80487515-80487537 CCCACTTGCAGGGGCCTGGGGGG - Intergenic
1152806484 17:82359293-82359315 CTCCCGAGGAGGGGTCTCTGAGG + Intronic
1153410681 18:4789338-4789360 GCCCCTAGGAGGTATCTGGGGGG - Intergenic
1153636577 18:7117912-7117934 CCCCGGGGGAGGGGTCTGGGTGG - Intergenic
1155148795 18:23105984-23106006 CCCTCAGGGAGGGTTCTGGGTGG - Intergenic
1157866957 18:51196435-51196457 CCACCGCGAAGGGGTCTGGGAGG - Intronic
1158410941 18:57205610-57205632 CCCACTAGGAGAGCTCAGGGAGG - Intergenic
1159001818 18:62981486-62981508 CCCTCTAGGAGGCCGCTGGGTGG + Intergenic
1160566217 18:79788171-79788193 CCCGCTAGGAGGGACCCGGGAGG - Intergenic
1160716650 19:579808-579830 ACCCCAGGGAGGGGTCTGAGGGG + Intronic
1160739581 19:679802-679824 TCCCCCAGGAGGCGTCGGGGAGG - Intronic
1160801890 19:974134-974156 CCCCTGGGGAGGGGGCTGGGGGG + Exonic
1160987084 19:1844039-1844061 CTGCCTAGCAGGGGTATGGGAGG + Intronic
1161116395 19:2499227-2499249 CCCCCTCCGTGGGCTCTGGGAGG - Intergenic
1161227117 19:3151845-3151867 CCCCCTAGGCTGGGCCTAGGTGG - Intronic
1161451897 19:4350855-4350877 CCACCTGGGAGGGGTGTGGAGGG + Intronic
1161966619 19:7552416-7552438 CCCCCAAGGCGGGGGCAGGGCGG + Intronic
1162029490 19:7911264-7911286 CCGGCTTGGTGGGGTCTGGGGGG - Exonic
1162034689 19:7932592-7932614 CCGCCTGGGAGGGGTCCTGGGGG + Intronic
1164541871 19:29127539-29127561 CCACCTGGGAGGTGTCTGTGGGG - Intergenic
1165037866 19:33047541-33047563 CTCCCTGGGAGCGGTCTGGCGGG + Intronic
1165882536 19:39053864-39053886 CACCCCGGGAGGGTTCTGGGCGG - Intergenic
1166599054 19:44077879-44077901 CCCCCGAGGAGGGGTCAGGGAGG - Intronic
1167011725 19:46813190-46813212 CCTCCCAGGAGGGGCCTGGAGGG + Intergenic
1167374498 19:49103677-49103699 CCCCCTAGGCCAGGGCTGGGTGG + Intronic
1167424395 19:49422614-49422636 CCCCCCAGGACGGGCCTGGGCGG - Exonic
1168063533 19:53907235-53907257 CCCCAGGGGCGGGGTCTGGGGGG - Exonic
925390912 2:3493315-3493337 CCCCCAAGGAGGGGCGTGTGAGG - Intergenic
925714206 2:6770164-6770186 CCCTGCAGGAGGGGTCAGGGAGG + Intergenic
927148765 2:20183963-20183985 ACCCACAGGAGAGGTCTGGGAGG + Intergenic
930358196 2:50346799-50346821 CCTCCTAGGAGTGGCGTGGGGGG - Intronic
931587256 2:63841669-63841691 CGCCCAAGCAGGGGTCGGGGAGG - Intronic
931881775 2:66576656-66576678 CCCACTAGGAGGGCGTTGGGAGG + Intergenic
932112176 2:69011818-69011840 GCCCCAAGGAGGGGTCCGTGTGG - Intergenic
932254550 2:70273087-70273109 CTCCCTGGGAGGGGGCGGGGTGG - Intronic
935639820 2:105280159-105280181 ACCCCTTGAAGGGGTCTTGGAGG - Intronic
936118528 2:109721884-109721906 CTCTCTAGGTGGGCTCTGGGTGG + Intergenic
938289397 2:130141439-130141461 CTGCCTTGGAGGGTTCTGGGGGG + Intronic
938467133 2:131531499-131531521 CTGCCTTGGAGGGTTCTGGGGGG - Intronic
939818288 2:146923106-146923128 CCCCATAGAAGGGGAGTGGGAGG + Intergenic
940092520 2:149936718-149936740 CCTCCTTGAATGGGTCTGGGTGG - Intergenic
940976591 2:159952682-159952704 CTCCCTTGGAGGGGTGTGGATGG + Intronic
944517972 2:200531446-200531468 GCCTCTAGAAGGGGTGTGGGAGG + Intronic
946374939 2:219302344-219302366 CCCCGTAGGAGTGGCCAGGGTGG + Exonic
947638456 2:231692788-231692810 GCCCCTAGGAGGGGAAAGGGTGG + Intergenic
947745096 2:232503315-232503337 GCCCCAGGGAGGGGTCTGGGCGG + Intergenic
948375800 2:237519599-237519621 CCCCCTAGGCGGGGTCCCTGGGG + Intronic
948641740 2:239379518-239379540 GCTCCCAGGAGGGGTCTGGCAGG + Intronic
1170935622 20:20806409-20806431 CCATATAGGCGGGGTCTGGGGGG + Intergenic
1171466153 20:25329238-25329260 CCCCACAGGAGTGGCCTGGGCGG + Intronic
1172092782 20:32445870-32445892 CCCCCAAGGAGGGATGGGGGGGG - Exonic
1173110670 20:40185172-40185194 CCCCAGAGGAGGGGTCTGGTGGG - Intergenic
1174197876 20:48786179-48786201 CTCCCTGGGAGGGGTCCTGGTGG + Intronic
1174371199 20:50089309-50089331 CCTCCAAGGAGGGGGCTTGGCGG + Intronic
1174420650 20:50397020-50397042 ACCCCAAGTAGGGGGCTGGGGGG - Intergenic
1175093090 20:56520599-56520621 CCACCAAGGAGGGAGCTGGGAGG + Intronic
1175793513 20:61757238-61757260 GCCCCCTGGAGGGGGCTGGGGGG - Intronic
1176021691 20:62965444-62965466 CCCCCTAGAGGAGGTCTGGGAGG - Intronic
1176293677 21:5059394-5059416 CCACCAAGGAAGGGTGTGGGGGG + Intergenic
1179353956 21:40641249-40641271 CCCCATGGGTGTGGTCTGGGTGG + Intronic
1179392564 21:41007456-41007478 GCACCTAGGAGGGGGTTGGGAGG - Intergenic
1179863583 21:44204254-44204276 CCACCAAGGAAGGGTGTGGGGGG - Intergenic
1180030504 21:45203279-45203301 CCCCAAAGGAGGGGGCTGTGAGG - Intronic
1180128045 21:45805302-45805324 CCCCCCAGGTGGTGTCTGGGGGG + Intronic
1180625446 22:17190821-17190843 CCCCCTAGGAGGGAGCTTGCAGG - Intronic
1181172101 22:21015560-21015582 CCCCCTGGGTGGGGCCTGGGTGG - Intronic
1181349146 22:22243056-22243078 TGCTCTCGGAGGGGTCTGGGAGG + Intergenic
1181404445 22:22672845-22672867 CCCAATAGAAGGGGCCTGGGAGG - Intergenic
1181413038 22:22738409-22738431 CCCAATAGAAGGGGCCTGGGAGG - Intronic
1182663863 22:31943864-31943886 CACCAGAGGAGGGGACTGGGTGG - Intronic
1182715471 22:32353825-32353847 GCCCCCAGCAGGGGTCTGGTTGG - Intergenic
1183307509 22:37090450-37090472 GCCCTAAGGAGGAGTCTGGGAGG + Intronic
1183375769 22:37464183-37464205 TCCTCTAGCAGGGGTCAGGGAGG - Intergenic
1184294535 22:43515344-43515366 CCCATTTGAAGGGGTCTGGGAGG - Intergenic
1184410928 22:44325937-44325959 GCCCCTGAGAGGGGTCAGGGAGG - Intergenic
1184696017 22:46139541-46139563 CCTCCTGGGACGGGGCTGGGAGG + Intergenic
952234686 3:31466797-31466819 CCCCATAGGTGAGGCCTGGGAGG - Intergenic
954796178 3:53162163-53162185 CACCCTGGGAGGGGTCTCAGAGG - Intronic
955104829 3:55887828-55887850 CCACCTAGGTGGGGTGTGGCGGG + Intronic
955411929 3:58661362-58661384 CCCCCGAGGAGGGTACTGGCTGG - Intronic
961237009 3:125375526-125375548 CCCCCCAGGCTGGGCCTGGGAGG + Intergenic
961818079 3:129561509-129561531 CCTCCTTGGTGGGGGCTGGGCGG - Intronic
962350356 3:134651578-134651600 CTCCCTAGGAGGGAGTTGGGTGG + Intronic
964416772 3:156455960-156455982 CCCTCTAGCGGGGGCCTGGGGGG - Intronic
968043872 3:195612595-195612617 CCCCCCAGGAGGAGTCAGGTAGG - Intergenic
968704673 4:2072354-2072376 CCCCCTGCTTGGGGTCTGGGAGG - Intronic
968951805 4:3699380-3699402 GCCCCCAGGAGGGGTCTGTCTGG - Intergenic
969313257 4:6366608-6366630 CAGCCTAGGAGGGGTGTGGCAGG + Intronic
975038118 4:69710024-69710046 CCCCCAAGTAGGGCTCTGTGTGG + Intergenic
975492651 4:75005593-75005615 CCTGCTAGGAGGGATGTGGGGGG - Intronic
976220649 4:82754455-82754477 TGCCACAGGAGGGGTCTGGGTGG + Intronic
981172071 4:141636666-141636688 CCCCCCGGGAGGGAACTGGGTGG + Exonic
985913021 5:2897663-2897685 GCCCCCAGGAGGGGCCCGGGTGG + Intergenic
986773918 5:10996503-10996525 CCCTCGAGGAGGGGGCTCGGGGG + Intronic
989621664 5:43390453-43390475 ACCTCTAGGAGGGGTTAGGGAGG - Intronic
995027888 5:107445666-107445688 CATCCTTGGAGAGGTCTGGGTGG - Intronic
997590111 5:135067157-135067179 CCGGCAAGGAGGGGTCAGGGAGG - Intronic
999244700 5:150147635-150147657 CCGCCCAGGAGGGCTCTGAGGGG - Intronic
1001082113 5:168675081-168675103 CACCCTCGGCGGGGGCTGGGAGG + Intronic
1002073729 5:176696024-176696046 TCCCCCAGCAGGGGTCTGCGGGG + Intergenic
1002446662 5:179294449-179294471 CCCCCTAGGGTGGGTCTGCTGGG - Intronic
1004972994 6:20932821-20932843 TCCCCTAGGAGGGTTCTATGAGG - Intronic
1006034335 6:31199863-31199885 CCACCCAGGAGAGATCTGGGTGG + Intronic
1006042738 6:31269540-31269562 TGCCCTATGAGGGGACTGGGAGG + Intronic
1006717805 6:36131190-36131212 CCCAGTGGGAGGGGTCAGGGCGG + Intronic
1007339163 6:41179489-41179511 CCCCACAGGAGGGGTATGTGAGG - Intergenic
1007794682 6:44338013-44338035 CCGCCTGGGAGAGGCCTGGGAGG - Intronic
1007901798 6:45420314-45420336 CGCCCTAGAAGGGGCCTGGAAGG - Intronic
1012062985 6:94511515-94511537 CTCCCTTGGCGGGGTTTGGGTGG - Intergenic
1016774022 6:147884315-147884337 CCACCAAGGAGGCGTCTTGGTGG - Intergenic
1017067930 6:150547537-150547559 CCCCTTGGGAGGGAGCTGGGAGG + Intergenic
1019587953 7:1815030-1815052 CCACCTTTGAGGAGTCTGGGTGG + Intergenic
1019605670 7:1908999-1909021 CCCTCTAGGATGGGTCTGATGGG + Intronic
1020212707 7:6167843-6167865 CCGCCTGGGAGGGGTCTGCCAGG + Intronic
1021927542 7:25547700-25547722 CCTCCTAGGAGGGTCCTCGGAGG - Intergenic
1023022314 7:36021432-36021454 CGACCTAAGTGGGGTCTGGGTGG - Intergenic
1023798336 7:43811940-43811962 CCCACAAGGAGGGGTGGGGGAGG + Intergenic
1024766897 7:52669947-52669969 CCCCCAAGCAGGGATCTGGAGGG + Intergenic
1025250324 7:57347465-57347487 ACCCCAAGTAGGGGGCTGGGGGG + Intergenic
1026953814 7:74364412-74364434 CCCCCGGGGAAGGGGCTGGGGGG + Intronic
1029277524 7:99416015-99416037 CCCACTAGGATGGCTGTGGGTGG - Intronic
1029382898 7:100225081-100225103 CCTCCCAGGAAGGCTCTGGGTGG + Intronic
1029404467 7:100366435-100366457 CCTCCCAGGAGGGGGCTGGATGG + Intronic
1029699512 7:102237051-102237073 TCCCCTAGGAGGGAACTGGAGGG + Intronic
1033347177 7:140534586-140534608 CCCTCAAGGAGGGGGATGGGAGG + Intronic
1033730729 7:144176333-144176355 CCACCAAGGTGGGGTCTGGCAGG + Intergenic
1034164608 7:149015832-149015854 ACCCCTGGGTGTGGTCTGGGGGG - Intronic
1034927300 7:155132472-155132494 CTCCCTAGGAGCTGTCTGAGTGG - Intergenic
1036177953 8:6557023-6557045 CCACCTAGGAGGGGTGGGCGGGG + Intronic
1037788768 8:21919203-21919225 CAGCCTAGGTGGGGTGTGGGGGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1040549974 8:48430169-48430191 GCCCCAGGGAGGGGTCTGTGGGG + Intergenic
1043559644 8:81476982-81477004 CCTCCTATGAGGGTTGTGGGTGG + Intergenic
1049317196 8:141975574-141975596 CCCCTGAGGAGGGGTTTGGGTGG + Intergenic
1049512727 8:143037905-143037927 CCTCCTAGGTGGAGTCAGGGTGG - Intergenic
1052796952 9:32931571-32931593 CCTCCCAGGAGGGATCTGGGCGG - Intergenic
1052855056 9:33401943-33401965 CCCCTCAGGAGGGGACTGCGTGG + Intronic
1053683074 9:40498284-40498306 CCCCTCAGGAGGGGACTGCGTGG + Intergenic
1053933057 9:43126600-43126622 CCCCTCAGGAGGGGACTGCGTGG + Intergenic
1054280640 9:63126644-63126666 CCCCTCAGGAGGGGACTGCGTGG - Intergenic
1054296174 9:63333782-63333804 CCCCTCAGGAGGGGACTGCGTGG + Intergenic
1054347390 9:63980486-63980508 CCCCCTGGGAGGTAACTGGGAGG + Intergenic
1054394190 9:64638287-64638309 CCCCTCAGGAGGGGACTGCGTGG + Intergenic
1054428840 9:65143486-65143508 CCCCTCAGGAGGGGACTGCGTGG + Intergenic
1054445118 9:65306829-65306851 CCCCCTGGGAGGTAACTGGGAGG + Intergenic
1054485156 9:65714677-65714699 CCCCCTGGGAGGTAACTGGGAGG - Intronic
1054501539 9:65878049-65878071 CCCCTCAGGAGGGGACTGCGTGG - Intronic
1056500484 9:87203877-87203899 CTCCCAAGGTGGGGTCTGTGTGG - Intergenic
1059329939 9:113528603-113528625 CCACCTGGGAGGCATCTGGGAGG - Intronic
1060229976 9:121819126-121819148 CCCACTGGGAGGGGTCTGTTGGG + Intergenic
1060418504 9:123450244-123450266 CCCCCTATGCTGTGTCTGGGCGG + Intronic
1060976185 9:127766514-127766536 CCCCCCAGGAGGGGCATGGTGGG - Intronic
1190119895 X:47650911-47650933 CCCCCAAGGACGGGGGTGGGTGG + Intergenic
1190333658 X:49250234-49250256 CCTCCTAGGCCGGGTCCGGGAGG + Exonic
1195753820 X:108181334-108181356 CTCCCTAGGATGGGTGTTGGGGG + Intronic
1201896414 Y:18997290-18997312 CAACCTGGCAGGGGTCTGGGTGG + Intergenic