ID: 1146793312

View in Genome Browser
Species Human (GRCh38)
Location 17:35765011-35765033
Sequence CAGGTTTGTCAGAGGGATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 513}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146793312 Original CRISPR CAGGTTTGTCAGAGGGATGA GGG (reversed) Exonic
900356668 1:2268287-2268309 CAGGTGTCTCAGAGGGCTCAGGG + Intronic
901387892 1:8923173-8923195 CAGGTTTGTCTGACTGTTGAGGG - Intergenic
903371229 1:22837412-22837434 CAAGTTTATGAGAGGGATGGGGG + Intronic
904454436 1:30638866-30638888 CAGGTTTGGAAAAGGGAGGAGGG + Intergenic
906543382 1:46604955-46604977 AATGTTTGTCAGGTGGATGATGG - Intronic
906714914 1:47961069-47961091 CAGGTTTGTCAAAGGTCAGATGG - Intronic
908074388 1:60498160-60498182 CATGTTTGAAAGAGGGATGCTGG - Intergenic
908868752 1:68583354-68583376 CAGGTTTGTCAAAGAAAAGATGG - Intergenic
909499004 1:76312136-76312158 CAGGTTTGTCAAAGGTCAGATGG - Intronic
909992040 1:82235398-82235420 CAGGTTTGTCAAAGATAAGATGG + Intergenic
910954506 1:92687247-92687269 CAGGTTTGTCAAAGAGCAGATGG - Intronic
910957286 1:92720383-92720405 CAGGTTTGTCAAAGAGCAGATGG - Intronic
912162107 1:106997823-106997845 CAGGTTTGTCAGAGATCAGATGG - Intergenic
912902968 1:113672496-113672518 GTGGTTTGTCAGAGGGAAAATGG + Intronic
913310250 1:117483023-117483045 CAGGTTTGTCAAAGGTCAGATGG + Intronic
914219607 1:145667855-145667877 CAGGTTTGTCAAAGAGCAGATGG + Intronic
914472189 1:147990732-147990754 CAGGTTTGTCAAAGAGCAGATGG + Intronic
915067602 1:153239491-153239513 CAGGGTTTGCAGAGGCATGAGGG - Intergenic
915876349 1:159615433-159615455 AAGGTTTTTCAGAGGTACGAGGG - Intergenic
916565132 1:165968919-165968941 CAGGTTTGTCAAAGACCTGATGG - Intergenic
917391329 1:174540577-174540599 CAGGTTTGTCAGAGATCAGATGG + Intronic
917439811 1:175057385-175057407 CAGGTTTGTCAGAGATCAGATGG - Intergenic
919353018 1:196484011-196484033 AAGGTGTGTCAGAGTGAAGAGGG + Intronic
919459399 1:197858287-197858309 CAGGTTTGTTACATGGATGTTGG + Intergenic
919814304 1:201428064-201428086 CAGGTTTGGCAGAGGGTGGCGGG - Intronic
920872863 1:209808401-209808423 CAGGTGTATGAGAGGGATGAGGG + Intergenic
922976512 1:229788705-229788727 CAGGTTTGTCAGAGATCAGATGG - Intergenic
923784627 1:237055186-237055208 CACGTTTGGGAGAGAGATGACGG + Intronic
924065986 1:240222273-240222295 CAGGTTTGTCAAAGGTCAGATGG + Intronic
924384689 1:243490192-243490214 CATGTTTGGCAGAGGGATTTTGG - Intronic
924578969 1:245306745-245306767 AAGGCTTATAAGAGGGATGAAGG - Intronic
1063054725 10:2492297-2492319 CAGGTTTGTCAGAGATCAGATGG + Intergenic
1063219483 10:3953241-3953263 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1063604706 10:7512544-7512566 CAGCTTCCTCAGAGGGATAAGGG + Intergenic
1064213001 10:13376486-13376508 CAGGTGTGTAGGAGGGAGGATGG + Intergenic
1064701151 10:18023313-18023335 CAGGGATGTCAGAGGGTTCATGG + Intronic
1064758308 10:18592574-18592596 CAGGTTTGTCAAAGATCTGATGG - Intronic
1064898260 10:20263215-20263237 CAGCTTTGTCAAAGAAATGATGG - Intronic
1065075474 10:22074488-22074510 GGGGTCTGTCAGAGGGTTGAGGG - Intergenic
1066483082 10:35816328-35816350 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1068057175 10:52025610-52025632 CAGGTTTGTCAAAGGTCAGATGG + Intronic
1070643221 10:78183827-78183849 CAGGGGTGTCAGAGAGATGTTGG + Intergenic
1071207315 10:83296297-83296319 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1071319772 10:84442854-84442876 CAGGTTTGTCAAAGGTCAGATGG - Intronic
1071961378 10:90811403-90811425 CAGGTGGATCAGAGAGATGAAGG - Intronic
1073065785 10:100758469-100758491 CAGGTTTGTTGTAGGGATGTTGG + Intronic
1073349987 10:102812830-102812852 CTGGTAGGTCAGAGGGATCAGGG - Exonic
1076048511 10:127313780-127313802 CAGGTTCGCCTGAGGGCTGAGGG + Intronic
1076461421 10:130649949-130649971 CAGGCTTGTCAGTGGCATGGTGG - Intergenic
1077697535 11:4408017-4408039 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1077721101 11:4629724-4629746 CAGGTTTGTCAAAGATCTGATGG + Intergenic
1077987171 11:7364862-7364884 CAGCTGTGACAGATGGATGAGGG + Intronic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078726275 11:13934324-13934346 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1078895774 11:15595758-15595780 CAGGCTTGTGATAGGGATAAGGG - Intergenic
1079026954 11:16956630-16956652 CAGGTCTGTGACAGGGATAAAGG + Intronic
1079029755 11:16977676-16977698 CAGGTTTGGCACTGGGATGATGG - Intronic
1080209275 11:29766954-29766976 CAGGTTTGTCAAAGATCTGATGG + Intergenic
1081385055 11:42462055-42462077 TAGGTTTCTCAGAGGTCTGATGG + Intergenic
1082007642 11:47428670-47428692 CAGGTTGATGACAGGGATGAAGG - Intergenic
1082040672 11:47682280-47682302 CATGTTAGTCAGGGAGATGAAGG + Intronic
1082223234 11:49668364-49668386 CAGGTTTGTCATTAGGATCAAGG - Intergenic
1082830581 11:57614088-57614110 CAGGGTTGTTTTAGGGATGAGGG + Intronic
1082941446 11:58709571-58709593 CAGGTTTCTCAGTGGGAAGCAGG - Exonic
1085543414 11:77294855-77294877 CATGTTTGACAGAAGTATGAAGG + Intronic
1086243831 11:84727378-84727400 CAGGTTTGTCAAAGATCTGATGG + Intronic
1086271198 11:85069009-85069031 CAGGTTTGTCAGAGATCAGATGG - Intronic
1086777457 11:90857377-90857399 CAGCTTTGTCAGAGGTCAGATGG + Intergenic
1086804638 11:91225289-91225311 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1087010960 11:93513648-93513670 CAGGTTTGTCTGTGAGAGGAAGG + Intronic
1087063469 11:94005725-94005747 CAGGTTTGTCAGAGATCAGATGG + Intergenic
1087398537 11:97634252-97634274 CAGGTTTGTCAAAGAGCAGATGG + Intergenic
1087847945 11:102994420-102994442 CAGGAGTTTCAGAGGGATGTGGG + Intergenic
1088309953 11:108449493-108449515 CAGGTTTGTCAAAGAGCAGATGG - Intronic
1088508576 11:110551124-110551146 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1089753889 11:120671909-120671931 CAGGTTTGTCAAAGGTGAGATGG + Intronic
1090141571 11:124270396-124270418 CAAGTTTGTCAAAGGGATTCAGG - Intergenic
1090158871 11:124470516-124470538 CAGTGTTGTCAGTGGGATGTAGG + Intergenic
1090567527 11:128011322-128011344 CAGGTTTGTCAAAGATAAGATGG - Intergenic
1090720857 11:129471892-129471914 CAGGTTTGTCAGAGATCAGATGG - Intergenic
1091162652 11:133439124-133439146 CAGGTTGGTCAGAAGTATGGTGG + Intronic
1091453966 12:591507-591529 TAGGTTGGTCAGAGGGTTGGGGG + Intronic
1092661607 12:10744560-10744582 CAGGTTTGTCAAAGATCTGACGG + Intergenic
1092703681 12:11261172-11261194 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1092706256 12:11288437-11288459 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1093630690 12:21405635-21405657 CAGGTTTGTCAAAGGTCAGATGG - Intronic
1094521200 12:31191090-31191112 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1094760385 12:33525579-33525601 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1095719620 12:45386496-45386518 CAGGTATGACAGATGGATGCAGG - Intronic
1096360090 12:50977353-50977375 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1096510220 12:52123735-52123757 CAGCTTTGGCTGAGGGAGGATGG - Intergenic
1097237819 12:57551694-57551716 CAGGCTTGTTAAAGGAATGAAGG + Intronic
1097300955 12:58018428-58018450 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1097407827 12:59212607-59212629 CAGGTTTGAGAAAGGGAAGAAGG + Intergenic
1097470542 12:59985683-59985705 CAAGTTTGTCAAAGGTAAGATGG - Intergenic
1097499327 12:60382258-60382280 CAGGTTTGTCAGAGATCAGATGG + Intergenic
1097530445 12:60793205-60793227 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1097620003 12:61927868-61927890 CAGGTTTGTCAAAGGTCAGATGG - Intronic
1098116115 12:67178676-67178698 CAGGTTTGTCAGAGATCAGATGG - Intergenic
1098120090 12:67227379-67227401 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1099431339 12:82590027-82590049 CAGGTTTGTCAAAGGTAGGATGG - Intergenic
1099699578 12:86066417-86066439 CAGGTTTGTCAAAGGTAAGATGG - Intronic
1100115541 12:91298572-91298594 CAGGTTTGTCAGAGATCAGATGG + Intergenic
1100905300 12:99291865-99291887 CAGGTTTGTCAAAGATAAGATGG - Intronic
1101252264 12:102948112-102948134 AAAATTTGTCAGAGGGCTGAAGG + Intronic
1101926859 12:108979140-108979162 TTTGTTTGTCAGAGGGAGGAAGG + Intronic
1102153774 12:110707787-110707809 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1102609068 12:114095349-114095371 CAGGTTTCTCAGAGGAAGGTGGG + Intergenic
1103167523 12:118783107-118783129 CCGTGTTGTCTGAGGGATGAGGG + Intergenic
1106107972 13:26750811-26750833 GAAGTTTGTCACAGGGATGAAGG - Intergenic
1106611866 13:31291126-31291148 CAGGTTTGTCAAAGATCTGATGG + Intronic
1106617690 13:31345215-31345237 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1107079403 13:36358358-36358380 CAGCTGTGTCAGGGAGATGATGG - Intronic
1107244826 13:38281027-38281049 CAGGTTTGTCAAAGATAAGATGG - Intergenic
1107904680 13:45051163-45051185 GATGCCTGTCAGAGGGATGAAGG - Intergenic
1107968408 13:45617657-45617679 CAGGTTTGTCAGAGATCAGATGG + Intergenic
1109399562 13:61807786-61807808 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1110020398 13:70462261-70462283 CAGGTTTGTCAGAGATCAGATGG - Intergenic
1110313333 13:74076388-74076410 AAGGTTTGTCAGACAGGTGAGGG + Intronic
1110491225 13:76110423-76110445 CAGGTTTGTCAAAGATCTGATGG + Intergenic
1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG + Exonic
1111926467 13:94468689-94468711 CAGGTTTGTGATTGGGTTGAGGG - Intronic
1112860599 13:103825550-103825572 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1114603502 14:23975814-23975836 CAGGTTTGTCAAAGAGCAGATGG - Intronic
1114837803 14:26224140-26224162 TCAGTTTGTTAGAGGGATGATGG + Intergenic
1115855867 14:37628890-37628912 CAGGTTTGTCAAAGGTCAGATGG + Intronic
1116196852 14:41738203-41738225 CAGGTTTGTCAAAGGTCAGACGG - Intronic
1117210763 14:53496496-53496518 CAGGTTTGACAGAGGAATGGAGG - Intergenic
1117547271 14:56804092-56804114 CAGGTCTTTCAGAGGACTGAAGG - Intronic
1117576289 14:57101768-57101790 CAGGTTTGTCAAAGATCTGATGG + Intergenic
1118088680 14:62447640-62447662 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1118879008 14:69810387-69810409 CAGGTCTATCAGAGGGCTCAGGG + Intergenic
1120849904 14:89160337-89160359 CAGGTTGGTCAGTGTGCTGAAGG + Exonic
1121916526 14:97840771-97840793 AAGGGTTCTCAGCGGGATGAAGG + Intergenic
1122424841 14:101599836-101599858 CAGGTTTTTCTGAGGATTGAAGG - Intergenic
1124120762 15:26886485-26886507 CAGGGCTGTCTGAGGGCTGAAGG - Intronic
1124353921 15:28980895-28980917 CAGCTTTGTCAAAGGGCAGATGG - Intronic
1124894419 15:33762975-33762997 CAGGTTTGTCAAAGGTCAGATGG - Intronic
1125231953 15:37466415-37466437 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1125798801 15:42425948-42425970 CAGGGTTGGCTGGGGGATGAAGG - Intronic
1127125467 15:55807482-55807504 CAGGTTTGTCAAAGGTCAGAGGG - Intergenic
1127150498 15:56069645-56069667 CAGGTTTGTCAAAGAGCAGATGG + Intergenic
1128038415 15:64547593-64547615 CAGGTTACTCAGGAGGATGATGG + Intronic
1128828659 15:70745819-70745841 CAGGTTTGTCAAAGGTCAGATGG - Intronic
1129578931 15:76784743-76784765 CAGGTTTGTCAAAGGTCAGATGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131621649 15:94074156-94074178 CTGGTTTGACAGAGGCATGAGGG + Intergenic
1131924734 15:97369871-97369893 CAGCTTTGCCAGAGGCATGGAGG + Intergenic
1133786420 16:8977188-8977210 CAGGTTTGTCAAAGAGCAGATGG + Intergenic
1134195188 16:12154370-12154392 CAGGGGTGTCAGAGGGGAGAGGG - Intronic
1134434826 16:14246927-14246949 CAGGTTTGACAGAGTGCTGCTGG - Exonic
1134635030 16:15785661-15785683 CAGGTTTGTGGGTGGGAAGATGG - Intronic
1134880023 16:17737999-17738021 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1135001074 16:18777180-18777202 CAGGTTTGTCAAAGATCTGATGG + Intergenic
1137087782 16:36149825-36149847 TAGGTTTTTCGAAGGGATGAAGG - Intergenic
1137292296 16:47060191-47060213 GAGCTTTGGGAGAGGGATGAGGG + Intergenic
1137412552 16:48241752-48241774 CAGGTTTGTCAGAGATCAGATGG - Intronic
1137455560 16:48615232-48615254 CATGGTTGTCAGAGAGATGATGG - Intronic
1137765713 16:50976164-50976186 TGGGTTTGTCAGAGGGGTGAAGG - Intergenic
1138933232 16:61687585-61687607 AAGGTTTGTGTGAGGGCTGAAGG - Intronic
1139614844 16:68082708-68082730 CAGGGCTCTCAGAGGGCTGAAGG + Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1142184857 16:88689867-88689889 CCGGATTGTCAGAGGGAGGGTGG + Intergenic
1142216396 16:88832042-88832064 CACGTTTGAAGGAGGGATGAGGG - Exonic
1142757111 17:2023126-2023148 CAGGTCTGTGATAGGGATAATGG - Intronic
1143877145 17:10000512-10000534 CAGGTTGGTCAGAGAGATCTAGG + Intronic
1144076859 17:11727392-11727414 CAGGTTTTCCAGAGTGGTGAGGG - Intronic
1144415558 17:15042876-15042898 CAGATTTTTCAGAGGGAGGAAGG + Intergenic
1144433994 17:15223013-15223035 CAGGTTTGTCAAAGATCTGATGG + Intergenic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1147042720 17:37730804-37730826 CAGCTTTGCCAGAAGAATGAAGG + Intronic
1147964487 17:44186851-44186873 CAGGTTTCTCAGCGGAAGGAGGG - Intergenic
1149631810 17:58131918-58131940 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1150431342 17:65120224-65120246 CAGGGTGGTCAGTGGGATGGAGG + Intergenic
1150656850 17:67044935-67044957 CAACTTTGCCAGGGGGATGACGG - Intronic
1151108497 17:71647633-71647655 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1152230876 17:79113470-79113492 CAGGTCTGGCAGAGGGTTCAGGG - Intronic
1152405771 17:80097020-80097042 CAGGTGTGGCAGAGAGATGGGGG - Intronic
1203170322 17_GL000205v2_random:142609-142631 CAGGTTTGTCAGAGATCAGATGG + Intergenic
1153519025 18:5934572-5934594 GAGGTATTTCAGAGGGATGGAGG + Intergenic
1154288147 18:13079919-13079941 CAGGTTTGTCAGAGATCAGATGG + Intronic
1155127539 18:22894104-22894126 CAGGTTTGTCAAAGATCTGATGG - Intronic
1155476445 18:26239871-26239893 CAGGTTTGTCAGAGATCAGATGG + Intronic
1155478535 18:26260565-26260587 CAGGTTTGTCAGAGATCAGATGG + Intronic
1155637520 18:27973552-27973574 CAGGTATGTCATAGGGAAGTAGG - Intronic
1156434878 18:37116368-37116390 CAGGTTTGTCAAAGGTCAGATGG - Intronic
1156733357 18:40223149-40223171 CAGGTTTGGCACAGGGAACAGGG - Intergenic
1157073055 18:44432129-44432151 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1157235453 18:45961114-45961136 CAGGATTGTCAGAGAGAAGGTGG - Intronic
1157944901 18:51968192-51968214 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1158297229 18:56011848-56011870 CAGGTTTGTCAAAGGTCGGATGG + Intergenic
1159172064 18:64783748-64783770 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1159286233 18:66357485-66357507 CAGCTTTGTCTGAGGGGCGATGG - Intergenic
1159313369 18:66738511-66738533 CAGGTTTGTCAAAGAGCAGATGG + Intergenic
1159427200 18:68305212-68305234 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1159645405 18:70912387-70912409 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1159868009 18:73728815-73728837 CAGCTTTGGCAGAGGGGAGAGGG + Intergenic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1164069558 19:21754498-21754520 CAGGTTTGTCAAAGGTCAGATGG - Intronic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164650151 19:29885633-29885655 CAGGTAGGTCACAGAGATGAAGG - Intergenic
1165003320 19:32783247-32783269 CAGGTTTGTCAAAGATAAGATGG + Intronic
1165190622 19:34059945-34059967 CAGTTTTGGCAAAGGGATAATGG + Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166648073 19:44547562-44547584 AAAGTTTGTCAGAGGAAGGAAGG + Intergenic
1167669774 19:50844079-50844101 CAGGTTTCTCAGGTGGAGGATGG + Intergenic
1168213083 19:54905983-54906005 CAGATGTGTCAGAGGGACCACGG + Intergenic
925264847 2:2559885-2559907 CAGTTCTGTGACAGGGATGAGGG - Intergenic
925462945 2:4080233-4080255 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
925734372 2:6948491-6948513 CAGTTTTCTCAGCTGGATGATGG - Intronic
926389898 2:12378831-12378853 CAGGTTTTTCAGAATGATCAGGG + Intergenic
926402306 2:12510120-12510142 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
926606484 2:14903832-14903854 CAGGTGTGACAGGGGGATGGGGG - Intergenic
926858411 2:17282088-17282110 CAGGTATGTCAGTGGCATGATGG - Intergenic
927028358 2:19094115-19094137 CAGGTTTGTCAAAGATCTGATGG - Intergenic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928379715 2:30807314-30807336 CAGGTGTGTCTGATGGAGGAGGG + Exonic
928637089 2:33258001-33258023 CAGGTTTCTCAGAGGGTAAATGG - Intronic
928860295 2:35849340-35849362 CAGGTTTGTCAGAGATCAGATGG - Intergenic
929293282 2:40217272-40217294 CAGGTTTGTCAAAGATCTGATGG + Intronic
929306497 2:40368896-40368918 CAGGTTTGTCAAAGGGCAGATGG - Intronic
930323743 2:49886859-49886881 CAGGATTGTCTGAGCTATGAGGG - Intergenic
930623203 2:53666381-53666403 CAGGTTTGTCAGAGATCAGATGG - Intronic
930803488 2:55467003-55467025 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
931194604 2:60039435-60039457 CAGGTTTGTCAGAGATCAGATGG - Intergenic
931204221 2:60131475-60131497 CAGGTTTGTCAGAGATCAGATGG + Intergenic
931223057 2:60305765-60305787 CAAGTTTTTCAGAGGGGAGATGG + Intergenic
931558913 2:63535568-63535590 CAGGTTTGTCAGAGATCAGATGG - Intronic
932296108 2:70624610-70624632 CAGGTGGATCAGAGAGATGAAGG - Intronic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932662246 2:73665780-73665802 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
933069996 2:77845145-77845167 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
933100265 2:78246912-78246934 CAGGTTTGTCAGAGCTCAGATGG - Intergenic
934154480 2:89183427-89183449 CAGGTTTGTCAAAGATCTGATGG - Intergenic
934212756 2:89998513-89998535 CAGGTTTGTCAAAGATCTGATGG + Intergenic
935557794 2:104529331-104529353 CAGGTTTGTCAAAGATAAGATGG - Intergenic
935953539 2:108352448-108352470 CAGCTGTGGCAGAGGGATGGAGG + Intergenic
936079474 2:109422626-109422648 CAGGTCTGCCAGAGGAATGGCGG - Intronic
937192487 2:120117235-120117257 CAGGTTTCTCGCAGGGAAGAAGG - Intronic
937229953 2:120392324-120392346 GAGGCTTGTGAGAGGGATGGCGG + Intergenic
937233063 2:120411993-120412015 CAGGTTTGTCAGAGGTCAGATGG + Intergenic
937645706 2:124263931-124263953 CAGGTTTGTCAAAGATCTGATGG + Intronic
937723680 2:125133675-125133697 CAGGTTTGTCAAAGATAAGATGG - Intergenic
937931996 2:127213523-127213545 CAGGTTTGTCAAAGAGCAGATGG - Intronic
938874011 2:135513919-135513941 CAGGTTTGTCAAAGAGCAGATGG + Intronic
939381609 2:141443712-141443734 CAGGTTTGTCAGAGATCAGATGG + Intronic
940395355 2:153183752-153183774 CAGGTTTGTCAAAGAAAAGATGG + Intergenic
940827526 2:158429624-158429646 AAGGTTTTTCTGAGGGATTAAGG + Intronic
942135486 2:172920874-172920896 CAGGTCTGTCAGAAAGAGGAAGG - Intronic
942200358 2:173564773-173564795 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
942815893 2:180053816-180053838 CAGGTTTGTCAGAGATCAGATGG - Intergenic
943545462 2:189271365-189271387 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
945377925 2:209100999-209101021 CAGGATTTTCAGAGGGGTAAGGG + Intergenic
945847588 2:214965084-214965106 CAGGTTTGTCAGAGATCAGATGG - Intronic
947890394 2:233613335-233613357 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
947892029 2:233632118-233632140 CAGGTTTGTCAAAGGTCAGATGG + Intronic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948204491 2:236156108-236156130 CCGGTGTGTCAGGGGCATGAGGG - Intergenic
948524037 2:238559581-238559603 CAGCTTTATGACAGGGATGATGG - Intergenic
1169959899 20:11147989-11148011 CAGGTTTGTCAAAGATATGATGG + Intergenic
1170411436 20:16096365-16096387 CAGATTTGTGAGTGGGATTAAGG + Intergenic
1170726892 20:18937134-18937156 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1170769131 20:19317026-19317048 CAGGTTTGTCAAAGGTCAGATGG - Intronic
1170957013 20:20990898-20990920 CATGATTGTGAGAGGGATGTGGG + Intergenic
1171232886 20:23501395-23501417 CAGGTTTGTCCGATGGATTCAGG + Intergenic
1171365392 20:24619199-24619221 CAAGTTTGGCTGAGGGCTGAGGG - Intronic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172299707 20:33840436-33840458 CATGTTTGTCAGATGCAAGATGG - Intronic
1172620932 20:36318209-36318231 CAGGTTAGGCAGAGTGATAAGGG + Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1175047311 20:56119192-56119214 CAAGTATGTCAGAAGGACGAAGG + Intergenic
1176047226 20:63099247-63099269 CAGGTGGGTCTGAGGGAGGAAGG - Intergenic
1177543689 21:22529147-22529169 CAGGTTTGTCAAAGATCTGATGG + Intergenic
1178137679 21:29646250-29646272 CAGGTTTTTTATTGGGATGATGG - Intronic
1179183989 21:39069596-39069618 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1180602186 22:17028981-17029003 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1180640500 22:17294581-17294603 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1182096755 22:27630848-27630870 CAGGTGGCTTAGAGGGATGAAGG - Intergenic
1182420258 22:30245473-30245495 CAGGTTTGGGAGGGAGATGAGGG - Intronic
1183315022 22:37132329-37132351 CAGGGGTGTGAGTGGGATGAGGG - Intronic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
949685226 3:6562034-6562056 GAGGTTGGTCAGAGAGATGCTGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951179031 3:19637501-19637523 CAGGTTTGTCAAAGATAAGATGG - Intergenic
951899888 3:27646292-27646314 GAGGTAAGTCATAGGGATGAAGG - Intergenic
951917485 3:27817248-27817270 CAGGTTTGTCAGAGATCAGATGG + Intergenic
951963742 3:28358078-28358100 CAGATTTGACTGTGGGATGAGGG - Intronic
952522735 3:34178383-34178405 CAGCTTTGGCAGAGTGAAGAAGG + Intergenic
952575356 3:34767929-34767951 CAGGTTTATCAAAGGGCAGATGG - Intergenic
953516390 3:43596470-43596492 CAGGTTTGTCAAAGGTCAGATGG - Intronic
954195430 3:48994053-48994075 CAGATGTGTGAGAGGGAAGAGGG + Intronic
954488869 3:50881973-50881995 CAGGTTTGTCAAAGAGCAGATGG - Intronic
955833949 3:63033257-63033279 GAGGTTTGTGAGAGGGAGGGGGG - Intergenic
955982827 3:64544471-64544493 CAGGTTTGTCAAAGGTCAGATGG - Intronic
956156891 3:66307783-66307805 CAGGTTTGTCAAAGAGCAGATGG + Intronic
956806019 3:72812267-72812289 CAGTTTTGTCAGACAGATGATGG - Intronic
957354299 3:79061708-79061730 CAGGTTTGTCAAAGGTCAGATGG - Intronic
957626589 3:82660271-82660293 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
957640354 3:82845512-82845534 CAGGTTTGTCAAAGAAAGGATGG - Intergenic
957822709 3:85399272-85399294 CAGGTTTGTCAAAGAGCAGATGG + Intronic
958563574 3:95779483-95779505 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
958567540 3:95834266-95834288 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
959041662 3:101428974-101428996 CAGGTTTGTCAAAGATCTGATGG + Intronic
959136090 3:102423020-102423042 CAAGTCTGTCAGTGGGAAGAAGG + Intronic
963514278 3:146289179-146289201 CAGGTTTGTCAAAGAGCAGATGG + Intergenic
963927219 3:150963772-150963794 CAGGTTTGTCAAAGAGCAGATGG - Intronic
964581438 3:158243332-158243354 CAGGTTTGTCAGAGATCAGATGG + Intronic
965278504 3:166718775-166718797 CAGGTTTGTCAAAGATCTGATGG - Intergenic
965332262 3:167390247-167390269 CAGGTTTGTCAAAGATCTGATGG + Intergenic
967255598 3:187588784-187588806 CAGGTTTGTCAAAGGTCAGACGG + Intergenic
967767439 3:193296468-193296490 CAGGTTTGTCAGAGATCAGATGG + Intronic
969052909 4:4385854-4385876 CAGGATTCTCAGACGGCTGATGG + Exonic
970016630 4:11519439-11519461 CAGGCTTGTCAGAGGGTTGGGGG - Intergenic
970070709 4:12156443-12156465 CAGGTTTGTCAAAGATAAGACGG + Intergenic
970470030 4:16368573-16368595 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
970555529 4:17227738-17227760 CAGGTTTGTCAAAGAGCAGATGG + Intergenic
972180207 4:36455654-36455676 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
972219750 4:36940447-36940469 CAGGTTTGTCAAAGATCTGATGG - Intergenic
972742541 4:41901893-41901915 CAGGTTTGTCAAAGATCTGATGG + Intergenic
973251248 4:48062667-48062689 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
973628611 4:52797517-52797539 GAGGAGTGACAGAGGGATGAGGG + Intergenic
974119394 4:57620618-57620640 CAGGTTTGTCAAAGATCTGATGG + Intergenic
974182818 4:58405230-58405252 CAGGTTTGTCAAAGATCTGATGG - Intergenic
974233348 4:59146862-59146884 CAGGTTTGTCAAAGATAAGATGG + Intergenic
974427124 4:61755903-61755925 CAGGTTTGTCAGAGATCAGATGG + Intronic
974444119 4:61956820-61956842 CAGGTTTGTCAAAGGTCTGAAGG + Intronic
974504248 4:62747710-62747732 CAGGTTTGTCAAAGATCTGATGG - Intergenic
974577091 4:63739579-63739601 CAGGTTTGTCAAAGAGCAGATGG + Intergenic
974719242 4:65715664-65715686 CAGGTTTGTCAAAGATAAGATGG - Intergenic
975543092 4:75534269-75534291 CAGGTTTGTCAAAGGTCAGATGG - Intronic
975977917 4:80120441-80120463 CAGGTTTGTCAAAGATAGGATGG - Intronic
976383127 4:84423498-84423520 CAGGTTTGTCAAAGATCTGATGG - Intergenic
976606560 4:86988895-86988917 CAGGTTTGTCAAAGATAAGATGG - Intronic
977381974 4:96287020-96287042 GAGGTTTGTCAGAGAGAAAAGGG + Intergenic
977629337 4:99224362-99224384 CAGGTTTGTCAGAGATCAGATGG + Intergenic
978188422 4:105884998-105885020 CAGGTTTGTCAGAGATCAGATGG - Intronic
978338155 4:107691903-107691925 CAGGTTTGTCAAAGATAAGATGG - Intronic
978600968 4:110427473-110427495 CAGGTTTGTCAAAGATCTGATGG + Intronic
978636127 4:110809436-110809458 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
978694424 4:111559863-111559885 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
979861412 4:125697932-125697954 CAGGTTTGTCAAAGATCTGATGG - Intergenic
979953160 4:126920697-126920719 CAGGTTTGTCAAAGATAAGATGG - Intergenic
980653302 4:135749110-135749132 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
981263103 4:142746729-142746751 CAGGTTTGTCAAAGAGCAGATGG - Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981415426 4:144487279-144487301 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
981794489 4:148580777-148580799 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
981809936 4:148762361-148762383 CAGGTTTGTCAAAGATCTGATGG + Intergenic
983079659 4:163369678-163369700 CAGGTTTGTCAAAGAGCAGACGG - Intergenic
983201969 4:164870869-164870891 CAGGTTTGCCAGACATATGAGGG + Intergenic
983788482 4:171763778-171763800 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
983791281 4:171800540-171800562 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
984325907 4:178250107-178250129 CAGGTTTGTCAGAGATCAGATGG - Intergenic
984403943 4:179302812-179302834 CAGGTTTGTCAAAGATAAGATGG - Intergenic
984712231 4:182895506-182895528 CAGGTTCGAGAGAGGGAGGAAGG - Intronic
985159753 4:187032263-187032285 CAGGTTTGTCAGAGATCAGATGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
986490578 5:8285532-8285554 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
986569929 5:9154358-9154380 CAGGACTCTCAGAGGCATGAAGG + Intronic
987157052 5:15099216-15099238 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
987500938 5:18708759-18708781 CAGGTTTGTCAGAGATCAGATGG - Intergenic
987688029 5:21230129-21230151 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
987701662 5:21407997-21408019 CAGGTTTGTCAAAGATCTGATGG - Intergenic
988308606 5:29527903-29527925 CAGGTTTGTCAAAGATAAGATGG - Intergenic
989953993 5:50334931-50334953 CAGGTTTGTCAGAGATCAGATGG - Intergenic
990012220 5:51013179-51013201 CAGGTTTGACAGAGAGAAAAAGG + Intergenic
990233043 5:53735802-53735824 CAGGTTTGTCAAAGATAAGATGG + Intergenic
990659711 5:57999788-57999810 CAGGTTTGTCAAAGATCTGAGGG - Intergenic
990893540 5:60673110-60673132 CAGGTTGGTCAGGGTGATCAAGG - Intronic
991105918 5:62841933-62841955 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
991237047 5:64410790-64410812 CAGGTTTGTCAGAGATCAGATGG - Intergenic
992477029 5:77113371-77113393 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
992909152 5:81378193-81378215 CAGGTTTGTCAAAGGTCAGATGG - Intronic
992932028 5:81657831-81657853 CAGGTTTTTTAGAGGGAAGGAGG + Intronic
993406501 5:87517772-87517794 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
994566067 5:101446892-101446914 CAGGTTTGTCAAAGATCTGATGG - Intergenic
994739464 5:103599968-103599990 CAGGTTTGGTAGAGGGATAAAGG - Intergenic
995162319 5:108996544-108996566 CAGGTTTGTCAAAGATAAGATGG + Intronic
995691765 5:114834294-114834316 CAGGTTTGTCAAAGATCTGATGG - Intergenic
995750285 5:115446908-115446930 CAGGTTTGTCAGAGATCAGATGG - Intergenic
995810686 5:116103932-116103954 CAGGTTTGTCAAAGGTCAGATGG + Intronic
996057073 5:118993214-118993236 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
996484725 5:124018492-124018514 CAGGTTTGTCAAAGATAAGATGG + Intergenic
996515324 5:124363095-124363117 CAGGTTTGTCAAAGATAAGATGG - Intergenic
996521207 5:124427994-124428016 CAGGTTTGTCAAAGATAAGATGG - Intergenic
996649007 5:125850659-125850681 CAGGTTTGTCAAAGATCTGATGG - Intergenic
997255826 5:132427257-132427279 CAGGTCTTTTAGAGGGAGGAAGG + Intronic
998564283 5:143202783-143202805 CAGGTTTGTCAGAGATCAGATGG - Intronic
998789315 5:145748832-145748854 CAGGTTTGTCAAAGGGCAGATGG - Intronic
999983372 5:156979093-156979115 CAAATTTGGCAGAGGGATGATGG - Intergenic
999985505 5:157001016-157001038 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1001155956 5:169272681-169272703 CAAGTCTGGCAGAGGGATGATGG - Intronic
1002280101 5:178124804-178124826 CAGGTTTCTCAGAGCACTGAGGG - Exonic
1002719687 5:181250735-181250757 CAAATTTGTATGAGGGATGAAGG + Intergenic
1003438328 6:6115471-6115493 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1003520819 6:6857034-6857056 AACGTTTGTCAGAGGAGTGACGG + Intergenic
1004287901 6:14339613-14339635 CAGGTGGGTCAGGGGGAGGAGGG - Intergenic
1005789494 6:29283107-29283129 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1008362027 6:50631310-50631332 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1008492525 6:52101279-52101301 CAGGTTTGGAAGACGGAGGAGGG - Intergenic
1008864393 6:56192058-56192080 CAGGTTTGTCAAAGATAAGATGG - Intronic
1008865866 6:56208882-56208904 CAGGTTTGTCAAAGATAAGATGG - Intronic
1009248745 6:61273200-61273222 CAGGTTTGTCAGAGATCAGATGG - Intergenic
1009289052 6:61861497-61861519 CAGGTTTGTCAAAGATATAATGG + Intronic
1009474649 6:64075273-64075295 CTAGTTTGTCAGTGGGAAGATGG + Intronic
1009675982 6:66821854-66821876 CAGGTTTGTCAGAGAAATAATGG - Intergenic
1009722283 6:67487811-67487833 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1009880949 6:69565345-69565367 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1009956055 6:70454691-70454713 CAGGTTTGTCAGAGATCAGATGG + Intronic
1012522628 6:100138810-100138832 CAGGCCTGCCAGAGTGATGATGG - Intergenic
1012951942 6:105527459-105527481 CAGGTTTGTCAAAGATTTGATGG - Intergenic
1013435282 6:110098842-110098864 CAGGTTTGAGAGAGGGAGGTAGG + Intergenic
1013943694 6:115696738-115696760 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1014277672 6:119404819-119404841 CAGGTTTGTCAAAGATAAGATGG - Intergenic
1014306409 6:119748023-119748045 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1014572909 6:123032886-123032908 CAGGTTTGTCCAAGGCATTATGG + Intronic
1014585018 6:123187327-123187349 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1015247500 6:131091176-131091198 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1015781991 6:136877597-136877619 CAGGTTTGTCAAAGAGCAGATGG + Intronic
1015802904 6:137078556-137078578 CAGGTGTTTGAGAGGTATGATGG - Intergenic
1016736268 6:147483609-147483631 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1017285881 6:152675924-152675946 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1019183420 6:170207261-170207283 CAGGAGTGGCACAGGGATGAAGG + Intergenic
1019602567 7:1892664-1892686 CGGGTTTGTCATATGGATGAGGG - Intronic
1020338563 7:7084718-7084740 CAGGTTTGTCAGAGATCTGATGG + Intergenic
1020693399 7:11386994-11387016 CAGGTTTGTCAAAGGTCAGATGG + Intronic
1020743057 7:12046493-12046515 CTGGTTTCGCAGAGAGATGAAGG - Intergenic
1021103324 7:16608560-16608582 CAGATTTGCCAGAGGGAGGGAGG + Intronic
1021362908 7:19738633-19738655 GAGGTTTGTCAAAGGGACAAAGG + Intronic
1021492973 7:21239939-21239961 CAGGTTAGTGAGAGGGAGGTTGG - Intergenic
1021585341 7:22201829-22201851 CAGGTTTGGGAGTGGGATGGAGG + Intronic
1021916560 7:25439345-25439367 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1022058397 7:26765752-26765774 CAGGTTTGTCAAAGAGCAGATGG + Intronic
1022139736 7:27483090-27483112 GAAAATTGTCAGAGGGATGAAGG - Intergenic
1022558124 7:31320896-31320918 CATGATTGACAGAGAGATGAAGG + Intergenic
1022676131 7:32500889-32500911 CAGGTTTGTCAAAGAGCAGATGG + Intronic
1025755437 7:64334001-64334023 CAGGTTTGTCAAAGATAAGATGG - Intronic
1028099937 7:86807029-86807051 CAGGTTTGTCAAAGGTCAGATGG + Intronic
1028115020 7:86987053-86987075 CAGGTTTGTCAAAGGTCAGATGG - Intronic
1028258569 7:88632252-88632274 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1028306371 7:89270349-89270371 CAGGTTTGTCAAAGAGCAGATGG + Intronic
1028429499 7:90731137-90731159 CAGGTTTGTCAGAGATCAGATGG + Intronic
1028648684 7:93126203-93126225 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1029021269 7:97367064-97367086 CAGGTTTGTCAGAGATCAGATGG - Intergenic
1029386526 7:100247178-100247200 CAGCTATGTCAGAGAGTTGATGG - Intronic
1030159949 7:106497199-106497221 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1031101749 7:117489568-117489590 CAGGTATGTCAAAGATATGATGG + Intronic
1031651744 7:124299977-124299999 CAGGTTTGTCAAAGAGCAGATGG + Intergenic
1031831443 7:126631739-126631761 CAGGTTTGTCAAAGATAAGATGG - Intronic
1031948824 7:127869825-127869847 AACAGTTGTCAGAGGGATGATGG - Intronic
1034357777 7:150466473-150466495 TAGGTTTGTCTCAGAGATGAGGG + Intronic
1034944627 7:155253912-155253934 CAGGTGTGTTTGAGGGCTGAGGG - Intergenic
1035475588 7:159141933-159141955 CCGGTTTGACAGAGGCATGCTGG - Intronic
1035585819 8:772724-772746 CAGGTGTTTGAGAGGGATGTGGG + Intergenic
1035693634 8:1576748-1576770 CAGGTTTGTCAAAGATAAGATGG + Intronic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1036074240 8:5476882-5476904 CAGGTGTGACAGAGAGAAGAAGG + Intergenic
1036096466 8:5729674-5729696 CAGTTTTCTCTGAGGAATGATGG - Intergenic
1037028813 8:14074998-14075020 CAGGTTTGTCAAAGATAAGATGG + Intergenic
1037029037 8:14079140-14079162 CAGATTTGTCCGAGGGAGGGAGG + Intergenic
1037091966 8:14930818-14930840 AGGGCTTGTCAGAGGGGTGAGGG + Intronic
1037563394 8:20095250-20095272 CATCTGTGTCAGAGGGATGCAGG + Intergenic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1039632360 8:39125945-39125967 CAGGTTTGTCAGAGATCAGATGG + Intronic
1040070671 8:43184920-43184942 CAGGTTTGTCAGAGATCAGATGG + Intronic
1040446521 8:47500926-47500948 CAGGTTTGTCAAAGATCTGATGG + Intronic
1040844678 8:51824901-51824923 CAGGTTTGTCAAAGATAAGATGG - Intronic
1041293854 8:56334043-56334065 CAGGTTTGTCAAAGATCTGATGG + Intergenic
1041701222 8:60791216-60791238 CAGGTTTAGGAGAGGAATGAGGG + Intronic
1042508598 8:69588189-69588211 CAGGTCTGTAAGAGGGAGGGAGG - Intronic
1044179127 8:89166924-89166946 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1044235012 8:89820646-89820668 CAGGTTTGTCAAAGATAAGATGG + Intergenic
1044315408 8:90744864-90744886 CAGGTTTGTCAAAGATAAGATGG + Intronic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1046134855 8:110012261-110012283 CAGGTTTGTCAGAGATCAGATGG + Intergenic
1046245601 8:111556861-111556883 CAGGTTTGTCAGAGATCAGATGG + Intergenic
1047674257 8:127183077-127183099 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1048688545 8:136932391-136932413 AAGGTTTGCCTGAGGGATCAAGG - Intergenic
1049485273 8:142854786-142854808 CAGGTTTGTCAAAGGTTAGATGG - Intronic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1050141144 9:2516962-2516984 CAGGTTTGTCAAAGAGCCGATGG + Intergenic
1050973485 9:11907729-11907751 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1051487861 9:17627703-17627725 CAGTTATCACAGAGGGATGAAGG - Intronic
1052060963 9:23960906-23960928 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1052089446 9:24309961-24309983 CAGGTTTGTCAAAGATAAGATGG + Intergenic
1052280782 9:26730881-26730903 CAGGTTTGTCAGAGATCAGATGG + Intergenic
1052285266 9:26777735-26777757 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1052545351 9:29870569-29870591 CAGGTTTGTCAGAGATCAGATGG - Intergenic
1052770075 9:32679464-32679486 CAGGTTTGAGTCAGGGATGATGG + Intergenic
1053070726 9:35100282-35100304 CAGGTTTGAGAGAGGGAGAAAGG - Intronic
1055761010 9:79607656-79607678 CAGGTTTGTCAAAGGTCAGATGG + Intronic
1058214719 9:102219193-102219215 CAGGTTTGTCAAAGATAAGATGG + Intergenic
1059027005 9:110645626-110645648 CAGGTTTGTCAAAGAGCAGATGG - Intergenic
1060137963 9:121175673-121175695 CAAGTTTTTCAGAGAGTTGAAGG - Intronic
1060168032 9:121436255-121436277 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1061875664 9:133542358-133542380 CAGGTTTGTGAGAGGAAGGGAGG - Intronic
1186799045 X:13074884-13074906 GAAGTTTGTCAGAGGCTTGAGGG + Intergenic
1187244371 X:17540650-17540672 CAAGTTCTTCAGAGGGTTGACGG - Intronic
1187378634 X:18780231-18780253 CAACCTTGTCTGAGGGATGATGG + Intronic
1187839503 X:23472235-23472257 CAGGTTTGTCAGAGATCAGATGG + Intergenic
1187840741 X:23484855-23484877 CAGGTTTGTCAAAGGTGAGATGG - Intergenic
1188239097 X:27763410-27763432 CAGGTTTGTCAGAGATCAGATGG - Intergenic
1188892834 X:35631686-35631708 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1190099982 X:47515182-47515204 CAGATTTGTCAGAGAATTGAGGG + Intergenic
1190110747 X:47587503-47587525 CAAGTTGGTCAGAGGAGTGAGGG - Intronic
1191134395 X:57048294-57048316 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1191181668 X:57570493-57570515 CAGGTTTGTCAAAGATCTGATGG + Intergenic
1191216844 X:57941322-57941344 CAGGTTTGTCAAAGGTAAGATGG + Intergenic
1191261424 X:58326269-58326291 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1191613848 X:63146526-63146548 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1191622448 X:63232401-63232423 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1191657205 X:63611360-63611382 CAGGTTTGTCAAAGATAAGATGG - Intergenic
1191787349 X:64930694-64930716 CAGTTTTATCATAGGGATGCAGG - Intronic
1191994255 X:67073930-67073952 CAGGCTTTTCAGAGGGTGGAGGG + Intergenic
1192883145 X:75309127-75309149 CAGGTTTGTCAAAGATCTGATGG + Intergenic
1192957201 X:76084774-76084796 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1192957669 X:76090525-76090547 CAGGTTTGTCAAAGATCTGATGG + Intergenic
1192992544 X:76476079-76476101 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1193067167 X:77272820-77272842 CAGGTTTGTCAAAGATAAGATGG - Intergenic
1193072130 X:77317362-77317384 CAGGTTTGTCAAAGGTGAGATGG - Intergenic
1193094566 X:77532500-77532522 CAGGTTTGTCAAAGAGCAGATGG - Intronic
1193413971 X:81199585-81199607 CAGGTTTGTCAAAGGTCAGATGG - Intronic
1194030253 X:88804519-88804541 CAGGTTTGTCAAAGATAAGATGG - Intergenic
1194227515 X:91279610-91279632 CAGGTCTGTCTCAGGGATAAGGG - Intergenic
1194935875 X:99948214-99948236 CAGATTTCCCAGAGTGATGAAGG - Intergenic
1195008026 X:100706063-100706085 CAGTTGTGGCAGAGGGATGAAGG - Intronic
1195932435 X:110091992-110092014 CAGGTTTGTCAGAGATCAGATGG + Intronic
1196242683 X:113361652-113361674 CAGGTTTGTCAGAGATCAGATGG + Intergenic
1196459413 X:115914843-115914865 CAGGTTTGTCAAAGATAAGATGG - Intergenic
1196778764 X:119363238-119363260 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1199437034 X:147824256-147824278 CAGGTTTGTCAGAGATCGGATGG - Intergenic
1199488713 X:148375577-148375599 CAGCTTTGTCAAAGGGCAGATGG - Intergenic
1200056494 X:153464101-153464123 CAGGCTTGTCAGAGGGCAGGTGG - Intronic
1200743628 Y:6882302-6882324 CAGGTTTGTCAAAGGTCAGATGG - Intergenic
1201957518 Y:19642114-19642136 CAGGTTTGTCAAAGGTCAGATGG + Intergenic
1202044233 Y:20721764-20721786 CAGGTTTGTCAAAGATCTGATGG - Intergenic
1202586422 Y:26433026-26433048 CAGGTTTGTCAAAGATAAGATGG - Intergenic