ID: 1146793710

View in Genome Browser
Species Human (GRCh38)
Location 17:35766854-35766876
Sequence TCCGGGGCCCCAAGCCAGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146793710_1146793720 10 Left 1146793710 17:35766854-35766876 CCACACTGGCTTGGGGCCCCGGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1146793720 17:35766887-35766909 TCGACCCCCTGTGGGGAATTGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1146793710_1146793726 20 Left 1146793710 17:35766854-35766876 CCACACTGGCTTGGGGCCCCGGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1146793726 17:35766897-35766919 GTGGGGAATTGGGAGAGCCAGGG 0: 1
1: 0
2: 1
3: 36
4: 376
1146793710_1146793717 3 Left 1146793710 17:35766854-35766876 CCACACTGGCTTGGGGCCCCGGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1146793717 17:35766880-35766902 TCCAGCATCGACCCCCTGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1146793710_1146793716 2 Left 1146793710 17:35766854-35766876 CCACACTGGCTTGGGGCCCCGGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1146793716 17:35766879-35766901 CTCCAGCATCGACCCCCTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1146793710_1146793725 19 Left 1146793710 17:35766854-35766876 CCACACTGGCTTGGGGCCCCGGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1146793725 17:35766896-35766918 TGTGGGGAATTGGGAGAGCCAGG 0: 1
1: 0
2: 0
3: 40
4: 385
1146793710_1146793719 9 Left 1146793710 17:35766854-35766876 CCACACTGGCTTGGGGCCCCGGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1146793719 17:35766886-35766908 ATCGACCCCCTGTGGGGAATTGG 0: 1
1: 0
2: 1
3: 2
4: 39
1146793710_1146793727 28 Left 1146793710 17:35766854-35766876 CCACACTGGCTTGGGGCCCCGGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1146793727 17:35766905-35766927 TTGGGAGAGCCAGGGTGAGCTGG 0: 1
1: 0
2: 4
3: 35
4: 374
1146793710_1146793715 1 Left 1146793710 17:35766854-35766876 CCACACTGGCTTGGGGCCCCGGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1146793715 17:35766878-35766900 CCTCCAGCATCGACCCCCTGTGG 0: 1
1: 0
2: 1
3: 11
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146793710 Original CRISPR TCCGGGGCCCCAAGCCAGTG TGG (reversed) Exonic
900265434 1:1754748-1754770 TCAGGGGCCCCACCCCAGGGAGG + Intronic
900476706 1:2879522-2879544 GCCAGAGCCCCAACCCAGTGGGG - Intergenic
900540302 1:3199389-3199411 TCCGGAGCCCCTTGCCAGTGGGG + Intronic
900636731 1:3669616-3669638 TCCGGGGCCACAAAAGAGTGAGG - Intronic
900780729 1:4615700-4615722 ACAGGGGCCCCCAGCCAGTGGGG - Intergenic
901505541 1:9683013-9683035 TCCAGGGCCCAATCCCAGTGGGG - Intronic
902391039 1:16106667-16106689 TCCGTGGACCCTTGCCAGTGGGG - Intergenic
902618724 1:17638290-17638312 TCCTGGGCCTCTACCCAGTGTGG + Intronic
903875151 1:26468978-26469000 AGAGGGGCTCCAAGCCAGTGGGG + Exonic
904389733 1:30174369-30174391 TCCAGAGCACCTAGCCAGTGGGG - Intergenic
904463164 1:30692498-30692520 TCCAGGCCCCCAGTCCAGTGAGG + Intergenic
907884070 1:58577139-58577161 GCCGGGGCCCCGAGCCATGGTGG + Exonic
908053195 1:60255389-60255411 TCCTGGTCCCCATGCCTGTGTGG + Intergenic
908360909 1:63367711-63367733 TTCCGGACCCCAGGCCAGTGTGG + Intronic
909806130 1:79875803-79875825 TCTGGAGGCCCAACCCAGTGAGG - Intergenic
912056638 1:105607784-105607806 GCCAGGGCCCACAGCCAGTGAGG - Intergenic
922718352 1:227888193-227888215 ACCGGGTCCCCAAGGCGGTGGGG + Intergenic
1068538678 10:58268071-58268093 TCCGGCCCCCCAAGTCAGCGGGG + Intergenic
1070751279 10:78965365-78965387 ACAGGGGCCCCAAGCTGGTGGGG + Intergenic
1070964927 10:80524162-80524184 TCCTGGGCCCCAGGCCTCTGTGG - Exonic
1072524934 10:96263335-96263357 TCTGGGGCCCCCAGCCAGCATGG + Intronic
1073111584 10:101066056-101066078 TTGGGGACCCCAAGCCAGAGAGG - Intronic
1073326688 10:102647420-102647442 TCTGGTGCCCCAGGCCACTGGGG + Intronic
1074117100 10:110464528-110464550 CCCAGGGCACAAAGCCAGTGGGG + Intergenic
1075258694 10:120944922-120944944 CCAGGGGCCCAAAGCCAGTGTGG - Intergenic
1075652105 10:124134308-124134330 TCCAGGGCCCTGAGCCAGGGAGG + Intergenic
1075683053 10:124345915-124345937 TTCGGGGGCCCAATGCAGTGGGG + Intergenic
1077177880 11:1198788-1198810 TTGGGGGCAGCAAGCCAGTGGGG + Intronic
1077361852 11:2144359-2144381 TCCGGGCCCCCAAGCCAAGCCGG - Intronic
1077417745 11:2432741-2432763 CCAGGGTCCCCATGCCAGTGTGG + Intergenic
1080469109 11:32527994-32528016 TTCGGGGCTCCAAGCCAGGGTGG - Intergenic
1090231946 11:125113683-125113705 TCCGGGAGCCCAAGCCCCTGAGG - Intergenic
1091393127 12:138162-138184 TCCTGGGCCCCACCCGAGTGTGG + Intronic
1091823696 12:3493821-3493843 TGCGGGGCACCAAGGCGGTGCGG + Intronic
1092525547 12:9307402-9307424 CCTGGGGCCCCAAGCCAGAAAGG + Intergenic
1094025843 12:25958974-25958996 GCCGGGGCCTCCAGCCGGTGCGG + Intergenic
1094511305 12:31098085-31098107 CCTGGGGCCCCAAGCCAGAAAGG + Intronic
1094854833 12:34398306-34398328 TCCTGGGCCCCATGCCTCTGTGG - Intergenic
1094872461 12:34605941-34605963 TCCTGGGCCCCACGCATGTGCGG - Intergenic
1097552865 12:61098254-61098276 TGCTGGGCCCCAGGCCAGGGAGG + Intergenic
1101331671 12:103762282-103762304 TCCCTGCTCCCAAGCCAGTGTGG - Exonic
1102038628 12:109786644-109786666 GCAGGGGCCCCGAGCCAGTGGGG + Intronic
1102509420 12:113403990-113404012 TCAGTGGCCTCAAGCCAGGGGGG - Intronic
1103604543 12:122077407-122077429 TCCGGGGCTCAAAGCCAGTCTGG - Intergenic
1104102284 12:125624044-125624066 TCCAGGCCTCCCAGCCAGTGTGG - Intronic
1104140679 12:125983750-125983772 GGAGGGGCCCCACGCCAGTGTGG + Intergenic
1104808225 12:131603201-131603223 ACCTGGGCCCCAAGACCGTGTGG - Intergenic
1113705096 13:112425148-112425170 TCCGGGCGCCCACGCCACTGTGG - Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114492779 14:23113735-23113757 TGCCGTGCTCCAAGCCAGTGAGG - Intergenic
1116845710 14:49863008-49863030 TCCGGGGTCCCAACCCTGTAAGG - Intergenic
1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG + Intronic
1122810859 14:104287253-104287275 TCAGGGGCCCCAGGCCAGGCAGG + Intergenic
1125726286 15:41869954-41869976 TCCGGGGCCTCAGGCCCATGCGG - Exonic
1126021599 15:44407576-44407598 TTCGGGGCAAAAAGCCAGTGAGG - Intronic
1128262902 15:66244901-66244923 CCCTGGGACCCAAGGCAGTGGGG - Intronic
1128303316 15:66581029-66581051 TCCCAGGCCCACAGCCAGTGGGG - Intergenic
1131817222 15:96234152-96234174 TGCCTGGCCCCTAGCCAGTGGGG - Intergenic
1132111695 15:99106145-99106167 TCCGGGTCCCCATGCCATTCGGG - Intronic
1132374870 15:101322396-101322418 TCAGAGGCCCAAAGCCATTGAGG - Intronic
1132983161 16:2749559-2749581 TCTTGGGCCCCAGGCCAGGGGGG + Intergenic
1133007965 16:2895116-2895138 ACTGGGGCTCCAGGCCAGTGTGG - Intronic
1133278679 16:4652848-4652870 TCTGGGGCCCCCAGCCAGGCCGG - Intronic
1137484222 16:48878203-48878225 TCATGGGCCCTGAGCCAGTGGGG + Intergenic
1137541181 16:49362905-49362927 TCCTGGCCCCCAGTCCAGTGGGG - Intergenic
1142401500 16:89861011-89861033 TCCGGGGCCGCAGTGCAGTGCGG - Intronic
1143806552 17:9433212-9433234 GCCTGGACCCCAGGCCAGTGTGG + Intronic
1146183247 17:30710003-30710025 TCCCGGGCCCCTCGCCAGTGGGG - Intergenic
1146793710 17:35766854-35766876 TCCGGGGCCCCAAGCCAGTGTGG - Exonic
1149382888 17:56111206-56111228 GAATGGGCCCCAAGCCAGTGGGG - Intronic
1150301958 17:64054554-64054576 TCCGGGGCCACCAGGCAGTCAGG - Intronic
1152724140 17:81937001-81937023 TTCGGGGCCCCCAGTCAGAGCGG + Intronic
1156476766 18:37410404-37410426 TCCAGGGCTGCAGGCCAGTGTGG + Intronic
1158608465 18:58917201-58917223 TCTGGGGCCCTCAGCAAGTGAGG - Intronic
1159023843 18:63165436-63165458 TGCGGCTCCCCAAGCCAGGGAGG - Intronic
1160865105 19:1252877-1252899 GCCGGGGTCCCGAGCCAGGGCGG + Intronic
1161082314 19:2317406-2317428 TCCTCTGCCCCAAGCCAATGGGG - Intronic
1161392914 19:4030820-4030842 GCCTGGGCCCCAAGCATGTGGGG - Intronic
1162764919 19:12913251-12913273 TCCTGGGCCCCCTGCCAGCGTGG - Intronic
1162812538 19:13172862-13172884 TGGGGGGCCCTGAGCCAGTGTGG + Intergenic
1162907270 19:13831351-13831373 TCCTGGAGCCCAAGCCAGTCTGG - Exonic
1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG + Intronic
1164592915 19:29515933-29515955 TTAGGGGGCACAAGCCAGTGTGG + Intergenic
1165827452 19:38713440-38713462 ACATGGGCCCCAGGCCAGTGTGG - Intronic
1167333827 19:48872679-48872701 TCCGGGCCCCCAGCCCCGTGGGG - Intronic
1168072219 19:53959580-53959602 GCCTGGGCCCCAAGGGAGTGAGG - Intergenic
925634957 2:5934061-5934083 ACAGGGCCCCCAAGGCAGTGGGG - Intergenic
926046401 2:9712670-9712692 TCCTGGGCCCCAAACCACTGTGG + Intergenic
928116842 2:28551242-28551264 TCAGGGGCCCCCTACCAGTGTGG - Intronic
929608764 2:43254115-43254137 TCAGGGGCCAGATGCCAGTGAGG - Intronic
929918278 2:46154261-46154283 ACCCTTGCCCCAAGCCAGTGAGG + Intronic
931517631 2:63059222-63059244 CCCGGGTGCCCAGGCCAGTGCGG - Intergenic
932619752 2:73258566-73258588 TCTGGGGCCCCAAGCCAATGGGG - Exonic
935583752 2:104782705-104782727 TCCTGGGACCCATGCAAGTGAGG - Intergenic
936938419 2:117859500-117859522 CCCGGGACCCCAAGCCCGAGAGG + Intergenic
937230846 2:120397326-120397348 TCCATGGCCCCCAGCCTGTGAGG + Intergenic
945944318 2:215980293-215980315 TCTGGGGCTCCAGGGCAGTGAGG + Intronic
946083381 2:217147035-217147057 TCCAGAGCCCAGAGCCAGTGTGG - Intergenic
946360916 2:219218906-219218928 TCCCGGGCCCAGAGCCAGCGGGG - Exonic
948660707 2:239504868-239504890 CCGGGGGCCCCAGGCCGGTGGGG + Intergenic
1170912075 20:20582632-20582654 GCAGGGCACCCAAGCCAGTGAGG - Intronic
1172699841 20:36846301-36846323 TCAGGGGCCCCAAGGCTCTGAGG - Intronic
1172701593 20:36856548-36856570 TCCTGGGCCCAGGGCCAGTGGGG - Intronic
1174562697 20:51442888-51442910 TCCGGGGCCCCCAAACAGGGAGG + Intronic
1174674231 20:52337818-52337840 TCCGGGGCTCCATTCCACTGAGG + Intergenic
1175316952 20:58055155-58055177 TCCTGGGCCCCAACCCAGCCAGG - Intergenic
1175883217 20:62272321-62272343 CCTGGGGCCCCAAGACTGTGTGG - Intronic
1175936871 20:62518032-62518054 CCCTGGGCCCCCAGCCAGTGAGG + Intergenic
1175966329 20:62661832-62661854 CCCGGGGCCCTGAGCCGGTGGGG + Intronic
1176167325 20:63681002-63681024 TCCGGGCCCTCAGGCCAGGGGGG + Intronic
1177745427 21:25207473-25207495 CCCTGGGCCCCAAGCCAGCAGGG + Intergenic
1184903957 22:47466202-47466224 TCCAGGGCCACCAGCCAGTAAGG - Intronic
1185340397 22:50288344-50288366 GCCTGGGCCCCAAGCTTGTGGGG - Intronic
950194495 3:10999664-10999686 TGCTGGGCCTCAAGCCTGTGGGG + Intronic
950483067 3:13256692-13256714 TCCGGGACCCCAGGCCATGGTGG + Intergenic
950483742 3:13260783-13260805 TCCCGGGCCCCAGGACAATGTGG - Intergenic
951269082 3:20603161-20603183 ACTGGGGCCCCAGGCCAGTGGGG + Intergenic
954301438 3:49702763-49702785 ACCGGGGTCCCAGGTCAGTGAGG + Intronic
955392487 3:58531617-58531639 TCTGGGGCCCCAGGTCAGGGAGG + Intronic
962940272 3:140119059-140119081 TCCTGGGGCCCAAGTTAGTGGGG - Intronic
965901484 3:173645878-173645900 TCCTCGGCCCCCACCCAGTGAGG + Intronic
966001624 3:174955827-174955849 TCAGGGGCCCCACCCCAGCGAGG - Intronic
967420819 3:189270517-189270539 CCCAGGTCCCCACGCCAGTGAGG + Intronic
973605340 4:52581559-52581581 TCCGGAGCTTCAAGTCAGTGGGG - Intergenic
977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG + Intergenic
978555078 4:109971219-109971241 ACCACCGCCCCAAGCCAGTGTGG + Intronic
984140717 4:176001630-176001652 TCCAGTGACCCGAGCCAGTGTGG + Intronic
985881282 5:2640833-2640855 CCCGGGTCCCCAGGCCACTGGGG + Intergenic
985903000 5:2811638-2811660 TGGGGGGCTGCAAGCCAGTGTGG - Intergenic
998149298 5:139747774-139747796 ACCGGGCCCCCCAGCCAGCGCGG + Intergenic
999239136 5:150117591-150117613 TCCTTGGCCCCAGGCCAGGGTGG + Intronic
1002649757 5:180682514-180682536 TCCTGGGCCCCCAGCCAGGAAGG - Intergenic
1003630439 6:7781802-7781824 TCAGAGGCCCCATGTCAGTGGGG + Intronic
1005102464 6:22187361-22187383 TCCGGGGTCCCATGTCAGGGAGG - Intergenic
1010795743 6:80114637-80114659 TCCCGTGCCACAAACCAGTGAGG - Intronic
1011554182 6:88557387-88557409 TCCGGGACCCCAAGGCCCTGAGG + Intergenic
1015651366 6:135464701-135464723 TACCGGGCCCAAAGCCAGTCAGG + Intronic
1020004093 7:4772498-4772520 TTCGGGGCGCCAGGCCTGTGGGG - Intronic
1024897325 7:54275154-54275176 TCCTGGGGCCCTAGCCAGGGAGG - Intergenic
1027216702 7:76188441-76188463 GCTGGGGCTCCAAGTCAGTGTGG + Intergenic
1030820196 7:114085020-114085042 TCCGGAGCCCCAGCCCAGAGGGG - Intergenic
1034304646 7:150039134-150039156 TCGGGGGTCCTAAGCCGGTGGGG + Intergenic
1034789765 7:153957650-153957672 TCCTGGCCTCCAATCCAGTGGGG + Intronic
1034936394 7:155203330-155203352 TTGTGGGCCCCTAGCCAGTGAGG + Intergenic
1035201913 7:157273103-157273125 CCCAGGGCCCCAAGCCGGGGAGG - Intergenic
1035432106 7:158829811-158829833 TCCGAGGCCACAGGCAAGTGGGG - Intronic
1041394736 8:57378914-57378936 TCCAGGTCACCAGGCCAGTGAGG + Intergenic
1043500710 8:80852083-80852105 TCCAGTGCCCCCAGCCAGTAGGG + Intronic
1047502372 8:125452199-125452221 TCCGTGGCCCCAAGCCAGGCCGG - Intergenic
1049424927 8:142533704-142533726 CCCACGCCCCCAAGCCAGTGCGG - Intronic
1049616798 8:143579043-143579065 CTCGGGGCCCCAAGCCACAGGGG - Intergenic
1049711095 8:144063668-144063690 ACCGGGGCCCCAAGACTCTGTGG - Intronic
1053285366 9:36846761-36846783 TCGAGGGACCCAGGCCAGTGAGG + Intronic
1056177023 9:84045378-84045400 TCCCAGGCCCCTAGACAGTGTGG + Intergenic
1062022789 9:134327034-134327056 TCCCGGTCCCCAGGCCAGGGAGG - Intronic
1062420984 9:136482745-136482767 TCCGGGCCCCCGGGCCAGAGCGG - Intronic
1203778285 EBV:86181-86203 GCCGGGGCCTCCATCCAGTGGGG + Intergenic
1187050870 X:15694649-15694671 TCAGGGGCCCCATGAGAGTGTGG - Intronic
1195614729 X:106903290-106903312 TTAGGGGACCAAAGCCAGTGGGG + Exonic