ID: 1146793844

View in Genome Browser
Species Human (GRCh38)
Location 17:35767786-35767808
Sequence CACTGCCGCAGCCTCAATGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146793839_1146793844 25 Left 1146793839 17:35767738-35767760 CCCAGAGCCAGTACCTTTGAAGA 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1146793844 17:35767786-35767808 CACTGCCGCAGCCTCAATGTTGG 0: 1
1: 0
2: 0
3: 5
4: 85
1146793840_1146793844 24 Left 1146793840 17:35767739-35767761 CCAGAGCCAGTACCTTTGAAGAA 0: 1
1: 0
2: 0
3: 12
4: 107
Right 1146793844 17:35767786-35767808 CACTGCCGCAGCCTCAATGTTGG 0: 1
1: 0
2: 0
3: 5
4: 85
1146793842_1146793844 12 Left 1146793842 17:35767751-35767773 CCTTTGAAGAAGTAGAAATCTCC 0: 1
1: 0
2: 0
3: 14
4: 185
Right 1146793844 17:35767786-35767808 CACTGCCGCAGCCTCAATGTTGG 0: 1
1: 0
2: 0
3: 5
4: 85
1146793841_1146793844 18 Left 1146793841 17:35767745-35767767 CCAGTACCTTTGAAGAAGTAGAA 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1146793844 17:35767786-35767808 CACTGCCGCAGCCTCAATGTTGG 0: 1
1: 0
2: 0
3: 5
4: 85
1146793838_1146793844 26 Left 1146793838 17:35767737-35767759 CCCCAGAGCCAGTACCTTTGAAG 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1146793844 17:35767786-35767808 CACTGCCGCAGCCTCAATGTTGG 0: 1
1: 0
2: 0
3: 5
4: 85
1146793843_1146793844 -9 Left 1146793843 17:35767772-35767794 CCATCATTCAATGACACTGCCGC 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1146793844 17:35767786-35767808 CACTGCCGCAGCCTCAATGTTGG 0: 1
1: 0
2: 0
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146793844 Original CRISPR CACTGCCGCAGCCTCAATGT TGG Exonic
900638855 1:3678786-3678808 CCCTGCCCCAGCCCCACTGTGGG + Intronic
910112612 1:83698895-83698917 CCCTGCCTTAGCCTCATTGTGGG + Intergenic
912522431 1:110254840-110254862 CACTGCTGCAGCCTTCTTGTGGG - Intronic
915354447 1:155247804-155247826 CACAGCCTCAGCCTCAACGGGGG - Exonic
922672213 1:227519157-227519179 CACAGCCCCAGCCTCATTGCAGG - Intergenic
924941719 1:248816737-248816759 CACCGCCACTGCCTCAATCTGGG + Intronic
1065950294 10:30645378-30645400 CACTGCCGCATCCTGAACGCAGG - Intergenic
1074498438 10:114000647-114000669 CTCTTCCGCTTCCTCAATGTTGG + Intergenic
1081317016 11:41642077-41642099 CCCTGCCACAGCCACCATGTGGG + Intergenic
1081676496 11:44972999-44973021 CACTGAGCCAGCCTCAATCTGGG - Intergenic
1084062505 11:66685556-66685578 CAGTGCCGCACCCTCAACATAGG - Exonic
1084494808 11:69497647-69497669 CACTGCAGCAGCCTCTGTGCAGG + Intergenic
1085645286 11:78218618-78218640 CATGGCCTCAGCCTCAAAGTGGG + Exonic
1089556367 11:119317642-119317664 CACTGCCTCAGCCTCAGTGCTGG + Intronic
1093752211 12:22812684-22812706 CACAGCAGCATCATCAATGTCGG + Intergenic
1096402132 12:51316069-51316091 CACTGCCACAGCCTTAGTCTAGG + Intronic
1097374091 12:58819589-58819611 CCCTGCGGCAGCCTCCAGGTGGG - Intergenic
1100138477 12:91585877-91585899 AACTGCTGCAGCCTGAATGAAGG - Intergenic
1104019156 12:124980328-124980350 CCCTGCCACAGCCTCAAGGGAGG + Intronic
1104587056 12:130055992-130056014 CACTGCTGCACCCTCCATGCCGG - Intergenic
1107575021 13:41709324-41709346 CATTGCCACGGCCACAATGTGGG + Intronic
1120755971 14:88244689-88244711 CACTTCTGCAGCCTGAATGCAGG - Intronic
1121591360 14:95114213-95114235 GACTGCCCCAGCCTTGATGTTGG - Intronic
1125285387 15:38087399-38087421 CACTGCTGCTGAATCAATGTGGG - Intergenic
1129255881 15:74333828-74333850 CACTGCCACAGCCTCCAGCTGGG + Intronic
1130015880 15:80186055-80186077 CACTGCCGCTGCCTAGGTGTTGG + Intronic
1131638797 15:94267155-94267177 CACTGCCGCAATCATAATGTAGG + Intronic
1131996573 15:98138636-98138658 CACTGCCGCTGGCTCATTTTTGG - Intergenic
1135402939 16:22178650-22178672 CACAGTCACAGCTTCAATGTGGG + Intronic
1139958566 16:70704995-70705017 CACTTCCCCATCCTCACTGTTGG + Intronic
1146627296 17:34444325-34444347 CACTGCTGCAGCTTCATTTTGGG - Intergenic
1146793844 17:35767786-35767808 CACTGCCGCAGCCTCAATGTTGG + Exonic
1147697465 17:42366722-42366744 CACTGACGCAGCCTTAATCCAGG + Intronic
1158879045 18:61758857-61758879 CACTGCCCCAGCCTCTGGGTAGG - Intergenic
1160077800 18:75694456-75694478 CACAGCAGCAGACTCAGTGTGGG - Intergenic
1161041207 19:2111593-2111615 CACTCCTGCAGCCTCCATGCGGG - Intronic
1163653280 19:18531431-18531453 CCATGCAGCAGCCTCAAGGTAGG + Intergenic
1165175787 19:33928944-33928966 CACTGCAGCCCCCTCATTGTGGG + Intergenic
1167842108 19:52130790-52130812 CACTGCTGCAGCCTGTGTGTGGG - Intronic
927141888 2:20136401-20136423 CACTGCCCCCGCCTCACTGCAGG - Intergenic
930012922 2:46951388-46951410 CACAGCCACAGCCTCAAACTTGG - Intronic
940131704 2:150389152-150389174 CACTGAAGCTGCCTTAATGTTGG + Intergenic
942104430 2:172618857-172618879 CACTTCTCTAGCCTCAATGTGGG - Intergenic
944992541 2:205254617-205254639 CATTACTGGAGCCTCAATGTAGG - Intronic
947930211 2:233958715-233958737 CTCTGCTGCATCCACAATGTGGG + Intronic
1168938479 20:1688493-1688515 ACCTGCCCCAGCCTCACTGTGGG - Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1173221830 20:41137714-41137736 CTCTGCCGCAGCCTCGAGGTGGG + Exonic
1174431851 20:50475901-50475923 CACTGCTCCTGCCTCATTGTCGG + Intergenic
1175036063 20:56003271-56003293 CACTGCCGCTGCCTCGGAGTAGG - Intronic
1179470368 21:41606115-41606137 CACTGTCGCAGGCTGAATGGTGG + Intergenic
1183297261 22:37037657-37037679 CACTGGCGAAGCCTCCATGCAGG - Intergenic
950108013 3:10400553-10400575 CACTGCTGCAGCCTTAGTGCCGG + Intronic
951633099 3:24742494-24742516 TCCTGCCTCAGCCTCCATGTTGG - Intergenic
951909968 3:27739618-27739640 TACTGCTGTATCCTCAATGTTGG + Intergenic
954959389 3:54550793-54550815 CACTGTCCCAGCATCCATGTGGG - Intronic
959421181 3:106131040-106131062 CACTGCAGCAGGCTCAGTGCAGG - Intergenic
961365773 3:126398335-126398357 CCCTGCCTGAGCCTCACTGTGGG + Intronic
965838326 3:172875756-172875778 CACTGCCGTGGCCCCACTGTGGG + Intergenic
978428589 4:108608348-108608370 AAATGCCACATCCTCAATGTTGG + Intergenic
992365174 5:76083450-76083472 CACTGCAGCCGCCTCAGTGCGGG - Exonic
994926451 5:106122177-106122199 CAGTGCCGCAGCCCCAATCCAGG - Intergenic
997489042 5:134257317-134257339 CGCTGCAGCAGCCTAAATGTTGG + Intergenic
997941239 5:138159452-138159474 CACTGCCACAGTCTGCATGTTGG + Intronic
998933318 5:147205283-147205305 CACTGCCAAAGCCACACTGTTGG - Intergenic
999119867 5:149200886-149200908 CACTGCATCAGCTTCACTGTGGG + Intronic
1001175216 5:169462218-169462240 CTATGCCACAGCCTCATTGTGGG + Intergenic
1007485670 6:42179037-42179059 CTCTGCCCCAGCCACAAAGTTGG + Intronic
1018029240 6:159829109-159829131 AACTGCCTCAGCCTAAATGCTGG - Intergenic
1019611037 7:1936715-1936737 CGCGGCGGCAGCCTCAAGGTCGG + Exonic
1021093830 7:16512479-16512501 CACCGGCTCATCCTCAATGTTGG + Intronic
1021796826 7:24263851-24263873 CACTGCCTCTGCCTCAGTTTGGG + Intergenic
1022301382 7:29105796-29105818 CACAGCCACATCCTCAGTGTTGG + Intronic
1022562938 7:31368982-31369004 CCCTGCCGCAGCGTCAAGGCAGG + Intergenic
1031907330 7:127475245-127475267 AATAGCCGCAGCCTCACTGTCGG + Intergenic
1034348490 7:150401571-150401593 CACTGCCCCTGCCACAATGCAGG - Intronic
1035556811 8:573208-573230 CACGGCTGCATCCTTAATGTTGG - Intergenic
1036678847 8:10855774-10855796 CACTCCCGGAGCCTAAATGCAGG - Intergenic
1038794336 8:30696462-30696484 CTCAGCCGCAGCGTCATTGTTGG - Exonic
1038829353 8:31040011-31040033 CACTTCCGCTGCTACAATGTTGG - Intronic
1047424236 8:124730688-124730710 TCCTGCCTCAGCCTCCATGTTGG + Intergenic
1052660220 9:31419638-31419660 CACTGCTGCAGCATCCAGGTTGG - Intergenic
1061084111 9:128389430-128389452 GACTCCAGCAGCCTCAGTGTGGG - Exonic
1187093516 X:16122340-16122362 CATGGCAGCAGCCTCAGTGTTGG + Intergenic
1188188303 X:27144170-27144192 CATTGCTGCAGCCTAAATTTTGG + Intergenic
1191705848 X:64093859-64093881 CTCTGCCCCAGCCTCAAAGTAGG - Intergenic
1192063389 X:67854604-67854626 CACAGGCGCATCCTCAATCTTGG + Intergenic
1195321643 X:103726059-103726081 CACTGCCGCTGCCGCACTGTGGG + Intronic
1197082561 X:122437594-122437616 CACAGACCCACCCTCAATGTGGG - Intergenic
1198963476 X:142205321-142205343 GGCTGACGCAGCGTCAATGTGGG + Intergenic
1200419337 Y:2946958-2946980 CACTGGCGCAGGCGCAATCTTGG - Intronic