ID: 1146794285

View in Genome Browser
Species Human (GRCh38)
Location 17:35770224-35770246
Sequence GGTCCCTGAGCCGCCGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 178}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146794285_1146794291 16 Left 1146794285 17:35770224-35770246 CCCGCGGCGGCGGCTCAGGGACC 0: 1
1: 0
2: 3
3: 22
4: 178
Right 1146794291 17:35770263-35770285 GAAGTGCGCTTCGCCGCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 29
1146794285_1146794292 17 Left 1146794285 17:35770224-35770246 CCCGCGGCGGCGGCTCAGGGACC 0: 1
1: 0
2: 3
3: 22
4: 178
Right 1146794292 17:35770264-35770286 AAGTGCGCTTCGCCGCGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 16
1146794285_1146794287 -9 Left 1146794285 17:35770224-35770246 CCCGCGGCGGCGGCTCAGGGACC 0: 1
1: 0
2: 3
3: 22
4: 178
Right 1146794287 17:35770238-35770260 TCAGGGACCAGCGCTCATCTTGG 0: 1
1: 0
2: 0
3: 20
4: 216
1146794285_1146794294 25 Left 1146794285 17:35770224-35770246 CCCGCGGCGGCGGCTCAGGGACC 0: 1
1: 0
2: 3
3: 22
4: 178
Right 1146794294 17:35770272-35770294 TTCGCCGCGGCGGGGCAGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1146794285_1146794289 12 Left 1146794285 17:35770224-35770246 CCCGCGGCGGCGGCTCAGGGACC 0: 1
1: 0
2: 3
3: 22
4: 178
Right 1146794289 17:35770259-35770281 GGTCGAAGTGCGCTTCGCCGCGG 0: 1
1: 0
2: 1
3: 2
4: 15
1146794285_1146794293 21 Left 1146794285 17:35770224-35770246 CCCGCGGCGGCGGCTCAGGGACC 0: 1
1: 0
2: 3
3: 22
4: 178
Right 1146794293 17:35770268-35770290 GCGCTTCGCCGCGGCGGGGCAGG 0: 1
1: 0
2: 1
3: 25
4: 177
1146794285_1146794290 15 Left 1146794285 17:35770224-35770246 CCCGCGGCGGCGGCTCAGGGACC 0: 1
1: 0
2: 3
3: 22
4: 178
Right 1146794290 17:35770262-35770284 CGAAGTGCGCTTCGCCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146794285 Original CRISPR GGTCCCTGAGCCGCCGCCGC GGG (reversed) Exonic
900105628 1:979663-979685 GTTCCCAGAGCCGACGCCGCTGG - Exonic
900790134 1:4674581-4674603 GGTCCCTGAGCCCCAGCAGCTGG + Intronic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
901805496 1:11736170-11736192 GGCACCTGCGCCGCAGCCGCGGG - Exonic
902747309 1:18482430-18482452 GGCCCCGGAGCCGGCGCTGCAGG - Exonic
907118692 1:51990506-51990528 GGTCCCTGATCCTCCGCGGGCGG + Intronic
907160969 1:52368631-52368653 GGTCCCCGAGCCGCGGCGGGGGG - Intergenic
912776549 1:112509325-112509347 GGTCCCTGTGCCGTCGCCCGCGG + Exonic
918388766 1:184037060-184037082 GGGCCCCGGGCCGCCGCGGCGGG - Intronic
922853500 1:228754985-228755007 GGCCCCTGATCCGTCGCAGCCGG + Intergenic
923299869 1:232630604-232630626 GATCCGTGAGCCTCGGCCGCTGG + Intergenic
1066048781 10:31617288-31617310 GGTCTCTGAGCTGCCGCTACAGG - Intergenic
1069504941 10:68989195-68989217 GGTACCTGCGCAGCAGCCGCAGG - Exonic
1069962725 10:72087935-72087957 GGTCCCAGGGCCGCCGGCCCGGG + Intronic
1073503934 10:103967388-103967410 CGGGCCTAAGCCGCCGCCGCGGG + Exonic
1081773980 11:45665448-45665470 GGTCCCTGAGCCCCGGCCCCGGG - Exonic
1083448511 11:62726998-62727020 GGGCCCGGCCCCGCCGCCGCCGG + Exonic
1084128768 11:67118441-67118463 GGCCCCGGCGCCGCCGCCACGGG - Intergenic
1084376714 11:68782961-68782983 GGAGCCTGAGCCGGCGCCGCGGG - Intronic
1084636764 11:70398309-70398331 GGATCCTGAGACCCCGCCGCGGG + Intergenic
1089966076 11:122655952-122655974 GGTCCCCGAGCCCCCTCCCCTGG + Exonic
1092408016 12:8234223-8234245 GGTCCCTGAGCTGTCCCTGCAGG - Intergenic
1095875873 12:47079775-47079797 GCTCCCAGAGCCGGGGCCGCGGG + Exonic
1096482479 12:51951799-51951821 GGGCCCGGACCCGCCGCTGCCGG - Exonic
1097232825 12:57522735-57522757 GCTGCCGCAGCCGCCGCCGCAGG - Exonic
1101466797 12:104957967-104957989 GCTCCCCGCGCCCCCGCCGCCGG + Intronic
1102197415 12:111034873-111034895 GCCGCCAGAGCCGCCGCCGCCGG + Intronic
1102254060 12:111406028-111406050 CGCCCCCGGGCCGCCGCCGCCGG - Exonic
1103775505 12:123364305-123364327 GGTCCCGGACCCGCAGCCCCCGG + Intronic
1104854356 12:131895009-131895031 GGTCTCTGTGCCGCCGCGGCCGG - Exonic
1104865326 12:131950103-131950125 GGTCGCGTAGCCGCAGCCGCGGG + Intronic
1114566988 14:23639909-23639931 GGGCCCTCAGCCGCCTCCCCAGG - Intronic
1117377381 14:55129097-55129119 ACACCCCGAGCCGCCGCCGCAGG - Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122418579 14:101561705-101561727 ATTTCCTGGGCCGCCGCCGCCGG + Exonic
1122543356 14:102509672-102509694 GCGCTCTGAGCCGCCGCGGCCGG + Exonic
1122719914 14:103716131-103716153 CGTCCCCGGGCCGCCGCCTCAGG + Intronic
1125653059 15:41333070-41333092 GGTCCCTGGGCGGGCGCGGCGGG + Intronic
1129644692 15:77419720-77419742 GCTCCCGGGGCCGCCGCCGAGGG + Intronic
1129845403 15:78765728-78765750 AGTCCCTGAGACCCAGCCGCTGG - Exonic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1130613432 15:85381163-85381185 GGTCCCCGGGTCGGCGCCGCCGG + Intronic
1132779297 16:1614165-1614187 GCTCCCTGCGCCGCCTCGGCCGG - Intronic
1133348969 16:5089054-5089076 GGTCCCTGAGCTGTCCCTGCAGG - Intronic
1135607481 16:23836541-23836563 GGTCCCAGACGGGCCGCCGCGGG + Intronic
1136285135 16:29236366-29236388 GGACCCTGAGCCCCCACCCCGGG + Intergenic
1136452089 16:30359268-30359290 GGTCAATGCGCTGCCGCCGCAGG + Exonic
1136514987 16:30762574-30762596 GGGCCCTGAGCCCCCGTCGCCGG - Exonic
1136574888 16:31117676-31117698 GCTCCCTGTGCCGCCATCGCGGG - Exonic
1137454839 16:48610180-48610202 CGCCCCTTTGCCGCCGCCGCGGG + Exonic
1137614561 16:49838910-49838932 GGTCCCGGGGCCGCCCCCGCGGG + Intronic
1137673027 16:50290549-50290571 AGGCCCTGAGCCAGCGCCGCAGG - Exonic
1139361514 16:66402671-66402693 GCTTCCGGAGCCGCCGCCGCAGG - Exonic
1139848595 16:69937259-69937281 GGACCCTGAGCCCCTGCCTCTGG + Intronic
1139974796 16:70800987-70801009 GGTCCATGCGCCGGCGCCGGGGG - Exonic
1140069933 16:71640486-71640508 GTTCCCAAAGCCACCGCCGCTGG - Exonic
1140223112 16:73058194-73058216 CGGCCCCGCGCCGCCGCCGCCGG - Intronic
1141125959 16:81401335-81401357 GGTCACTGAGCTCCCGCCACGGG - Intergenic
1141430587 16:83968696-83968718 GCTCCGGGAGCCGCCGCAGCAGG + Exonic
1141732756 16:85833821-85833843 GGTCCCTGCTCCTCCGCAGCAGG + Intergenic
1142090198 16:88205990-88206012 GGACCCTGAGCCCCCACCCCGGG + Intergenic
1142306771 16:89290334-89290356 GAGCCCTGAGCCTCCCCCGCTGG - Intronic
1142306788 16:89290379-89290401 GAGCCCTGAGCCTCCCCCGCTGG - Intronic
1142306820 16:89290470-89290492 GAGCCCTGAGCCTCCCCCGCTGG - Intronic
1142863340 17:2776583-2776605 GGTCCCTGTGCCGCTGCCTGCGG - Intergenic
1143237938 17:5419372-5419394 GGGCTCTTCGCCGCCGCCGCTGG + Exonic
1144107285 17:11997436-11997458 GCGCCCGGAGCCGGCGCCGCGGG - Intronic
1144807723 17:17978713-17978735 GGGCCCTGAGCCACAGCCCCGGG + Intronic
1146052885 17:29567051-29567073 GGGCCCTGGGCAGCCGCCGCCGG - Exonic
1146058604 17:29593234-29593256 GGCCCCGGGGACGCCGCCGCAGG - Intronic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1147317693 17:39628601-39628623 GGTCCCTGAGCCTCAGCTGGAGG + Intronic
1149461541 17:56833696-56833718 GATGCCGGCGCCGCCGCCGCCGG - Exonic
1151558730 17:74859994-74860016 GGCCCCGGAGCCGCGGACGCCGG - Intronic
1151969867 17:77452029-77452051 GATCCCAGTGCCGGCGCCGCGGG - Intronic
1152049084 17:77958760-77958782 GGAGCCGTAGCCGCCGCCGCCGG + Intergenic
1152545870 17:80999889-80999911 GTTCCATGAGCCCCAGCCGCGGG - Exonic
1152630012 17:81406696-81406718 GGCCCCAGAGCAGCTGCCGCGGG + Intronic
1152697797 17:81805241-81805263 GGTCCCTCAGCCGCCCCCAGTGG + Intronic
1153515163 18:5895440-5895462 CCGCCCCGAGCCGCCGCCGCGGG - Exonic
1155461543 18:26090178-26090200 CTTCCCTGAGCGGCCGCCGCCGG + Intronic
1156473914 18:37394102-37394124 GGTCCCCGAGCATCTGCCGCGGG - Intronic
1157662750 18:49460267-49460289 GGTCCCTTCGCCGCCGCCCCGGG + Intronic
1157867145 18:51197082-51197104 TGGCCCTGCGCCGCCGCTGCCGG + Exonic
1158729914 18:60011187-60011209 GGCCATTGAGCCGCCGCTGCCGG - Intergenic
1160701129 19:507920-507942 GGCCCCTGCGCCGGCGCTGCGGG - Intronic
1160726131 19:618605-618627 TGTCCCTGGGCCGCCCCCACCGG - Intronic
1160923891 19:1533827-1533849 CCTCCCGCAGCCGCCGCCGCAGG - Intronic
1161650246 19:5479977-5479999 GGTCCCAGAGCCCCAGCCACCGG + Intergenic
1162100332 19:8335070-8335092 GCTCGGTGAGCCGCCGCAGCTGG + Exonic
1163311737 19:16519108-16519130 GGTCCCACAGCCGGCACCGCTGG + Exonic
1164594850 19:29526118-29526140 GCTCCCGCAGCCGCCCCCGCCGG - Intergenic
1165424949 19:35740428-35740450 GGTCACGGCTCCGCCGCCGCAGG + Exonic
1165476351 19:36032912-36032934 GGTCCCTCCTCCCCCGCCGCCGG - Intronic
1168101462 19:54143650-54143672 GGTCCCTCAGCCGCTGCAGATGG - Exonic
1168297432 19:55384259-55384281 TGGCCCTGCACCGCCGCCGCTGG + Exonic
1168317290 19:55489860-55489882 TGTCCCTGCCCCCCCGCCGCAGG + Exonic
926154860 2:10448172-10448194 GGAGCCTGAGTCGCAGCCGCAGG + Exonic
927217351 2:20675502-20675524 GGCCCCTGAGCGGCCTCCCCTGG - Intergenic
932624154 2:73284542-73284564 GGTCCCGGCGCAGCCGCTGCTGG - Intergenic
932722461 2:74147934-74147956 GGACCGAGAGCCGCCGCCGTGGG + Exonic
933893084 2:86789082-86789104 GTTCCCAGAGCCGCTGCAGCGGG - Intronic
935622827 2:105144086-105144108 GCTCCCCGAGCCGCAGCTGCCGG - Intergenic
937317812 2:120943238-120943260 GGTCCCTGAGCTGGCACCTCTGG + Intronic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
941164957 2:162074353-162074375 GGTCCCCGAGTCGCCGGCCCAGG - Exonic
941664939 2:168235317-168235339 CGTCCCTGAGCCACCACGGCCGG + Intronic
944663418 2:201939733-201939755 GGTTCCTGAGCCCCGGCCGATGG - Intergenic
945241581 2:207681533-207681555 CCTCCCTGCGCCGCCGCCTCCGG - Intergenic
948643311 2:239388680-239388702 GGTCACTGGGCTGCAGCCGCAGG + Intronic
1168854946 20:1001999-1002021 GCCCCCAGAGCCGCCGCCCCCGG + Intronic
1169914503 20:10672794-10672816 GGACCCTGAGCCGAAGCTGCAGG + Exonic
1170600363 20:17836871-17836893 AGCCCCTGAGCTGCTGCCGCTGG - Intergenic
1171423033 20:25031748-25031770 GGTCCCTGAGAAGCTGCTGCTGG - Intronic
1171452924 20:25248470-25248492 GGTCCCGGAGCCGCGCCAGCGGG + Intronic
1172587265 20:36093469-36093491 GGTCCAGGCGCCGCCGCCGCTGG + Intronic
1175439480 20:58980994-58981016 GCTCGCAGAGCCGGCGCCGCAGG + Intergenic
1175715687 20:61253006-61253028 GATCCCTGGCCCGCAGCCGCCGG - Intronic
1175888167 20:62303787-62303809 TGTCCCTGAGCCGCAGCAGCAGG + Intronic
1178327929 21:31660152-31660174 GGTCCTTGGGCCGCCGCCGCGGG + Intronic
1179411798 21:41168190-41168212 AGTCGCTGAGCCGCGGCTGCCGG + Exonic
1181689221 22:24549095-24549117 GGTCCCTGAGCAGCCCCTGCAGG - Intronic
1183453010 22:37906720-37906742 GGTCCCTGAGACCCCGGCCCAGG + Intronic
1183883531 22:40857054-40857076 GGCCCGCGAGCCGCCTCCGCCGG + Intergenic
1184046690 22:41976661-41976683 GGTCCAGGAGCCGCCCCCGCGGG - Intronic
1184693190 22:46126635-46126657 GTGCCCTGGGCCGCCGCCCCAGG + Intergenic
1184796885 22:46738012-46738034 GGGCCCGGAGCCGGCGCCCCCGG - Exonic
1185074972 22:48678153-48678175 GGGCCCAGAGCAGCCGCCCCAGG - Intronic
1185338363 22:50280806-50280828 CATCCCTGAGCCGCGGCGGCCGG - Exonic
952867192 3:37862004-37862026 GCTCCCGCCGCCGCCGCCGCTGG - Intronic
954402832 3:50328025-50328047 TGCCTCTGAGCCGCCGCCTCCGG + Exonic
960914131 3:122680128-122680150 CCTCCCTGAGCCGCCACAGCTGG + Intergenic
960955218 3:123026840-123026862 GGGCCCTGAGCCACTGCCCCTGG + Intronic
961664399 3:128487034-128487056 AGACCCTGAGCCGCCGCCGCCGG - Exonic
961820559 3:129573664-129573686 CGTCACTGAGCCGCCGGCCCAGG + Exonic
963939793 3:151086657-151086679 AGTCCCTCCGCCGCCGCCACCGG + Intronic
966886529 3:184380389-184380411 GGGCTCTGGGCCGGCGCCGCGGG - Exonic
968230702 3:197003189-197003211 GCTACCTGAGGCGCCGCCCCCGG - Exonic
968353578 3:198081611-198081633 CGCCCCTGTGCAGCCGCCGCCGG + Intergenic
968510544 4:993626-993648 GGTCCCTAAGCCCCCCCGGCAGG - Intronic
968671833 4:1856184-1856206 GGCCCCTCAGCGCCCGCCGCTGG + Exonic
968835924 4:2964049-2964071 TGTCCTGGCGCCGCCGCCGCCGG - Exonic
968850569 4:3074975-3074997 GCTTCCTCAGCCGCCGCCGCAGG + Exonic
969252725 4:5980239-5980261 GGTCCCTGAGCTGGCACTGCAGG + Exonic
970437442 4:16049066-16049088 GGTTCCTGTGCTGCCGCCCCTGG + Intronic
971014632 4:22475453-22475475 GAACCGTGAGCCGCCGCCCCCGG - Intronic
973759065 4:54100577-54100599 GGCCCCTGCGCCCCCGCTGCCGG - Exonic
978503515 4:109433729-109433751 GGTACCTGAGCCGCGGTCCCGGG + Intergenic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
985529165 5:423854-423876 GGGCCCTGAGCAGCCTCCCCAGG - Exonic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
987258428 5:16179983-16180005 GATCCCTCAGCCGCCTCCACGGG + Intronic
988823979 5:34915924-34915946 GCGCACAGAGCCGCCGCCGCAGG - Exonic
991063637 5:62403731-62403753 GGGCCATCGGCCGCCGCCGCGGG - Exonic
992732796 5:79689783-79689805 GGAACCCGAGCCGCCCCCGCAGG + Intergenic
997104704 5:131005619-131005641 TCTCCCTGAGCCACCGCAGCTGG - Intergenic
997568194 5:134905280-134905302 GGTCCCTCAGCCGACGCCGCCGG - Intronic
998236396 5:140402048-140402070 GGCCTCGGAGCCGCCTCCGCCGG + Exonic
999248225 5:150166825-150166847 GGCCCTGGAGCCGCCGCTGCCGG - Exonic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1004228966 6:13814156-13814178 AGTCCCCGAGCTGCCGGCGCGGG + Exonic
1007621285 6:43216353-43216375 GGACCCTGAGCCACTGCTGCTGG + Exonic
1013155803 6:107490254-107490276 GCTCCCGCCGCCGCCGCCGCCGG - Exonic
1013422534 6:109979227-109979249 GCTCCTAGAGCCGCCGCAGCAGG - Exonic
1019526763 7:1483892-1483914 GGACCCTGAGCCAGCGCCGAGGG + Intronic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1021992595 7:26152436-26152458 GGTCCCGGCGCCCCAGCCGCCGG - Exonic
1023016341 7:35971602-35971624 GTTCCCTGCGCCGCCGCCTTCGG + Intergenic
1030659711 7:112206330-112206352 GGACTGTGAGCAGCCGCCGCCGG - Exonic
1031298337 7:120033529-120033551 GGTCCTTGAGCCGCCTGCTCAGG + Intergenic
1034273790 7:149815427-149815449 GGCCCCTGTGCCGCTGCCCCGGG + Intergenic
1035310055 7:157961897-157961919 GGTCCCGGTGCGGCCGCCGCCGG - Intronic
1035573314 8:688197-688219 GGCCCCTGAGCCGCCCACGCAGG + Intronic
1036765243 8:11545902-11545924 TGTCCCTGAGCAGCCCCCACAGG + Intronic
1037877424 8:22554827-22554849 GGGCCCTGAGCTGCCGCTCCTGG + Intronic
1037928847 8:22865548-22865570 GGTGCCGGTGCCGCAGCCGCCGG + Intronic
1040076956 8:43246596-43246618 CGCCCCTGTGCAGCCGCCGCCGG - Intergenic
1045098946 8:98825892-98825914 CTTCTCTGGGCCGCCGCCGCAGG - Intronic
1049682172 8:143924282-143924304 GCTCCTCCAGCCGCCGCCGCTGG + Exonic
1049689832 8:143953587-143953609 GGTCGCTGAGCCAGAGCCGCAGG - Intronic
1049718247 8:144103803-144103825 GGCCGCTGAGCCCCCTCCGCCGG + Exonic
1049762201 8:144336655-144336677 GGGCCCGGCGCCGCCGCCCCCGG - Intergenic
1049782648 8:144435892-144435914 TGCCCCTGACCCGCAGCCGCCGG - Exonic
1049896240 9:113908-113930 GGCCTCTGCGCCGCCGCCCCCGG - Intergenic
1051896564 9:21994731-21994753 GGCCCCTGGGCCGTCACCGCGGG - Intronic
1053240099 9:36487906-36487928 CGCCCCTGAGGCGCGGCCGCGGG + Intergenic
1053313942 9:37036589-37036611 GGGCCCGGAGGCGCCGCTGCTGG + Intergenic
1053503410 9:38620895-38620917 TGTCCCGGTGCAGCCGCCGCCGG + Intergenic
1053503574 9:38621524-38621546 CGCCCCTGTGCAGCCGCCGCCGG + Intergenic
1053725143 9:40991973-40991995 GCTCCCAGACGCGCCGCCGCAGG + Intergenic
1054731270 9:68705011-68705033 GGCGCCTGTCCCGCCGCCGCTGG - Intergenic
1054775792 9:69122328-69122350 GCCCGCTGAGCCTCCGCCGCGGG + Intronic
1054835654 9:69672553-69672575 GGTGCCGCCGCCGCCGCCGCGGG - Intergenic
1055612032 9:78032441-78032463 GCTCCCTGCGGCGCCGGCGCTGG + Intergenic
1056386247 9:86099470-86099492 GGTCGCTCTCCCGCCGCCGCCGG + Exonic
1057019110 9:91681914-91681936 GGTCCGTGCGGCGCCTCCGCGGG - Intronic
1057152553 9:92808373-92808395 CGTCCCTGTGCAGCCGCCGCGGG - Intergenic
1057152641 9:92808698-92808720 TGCCCCTGTGCAGCCGCCGCAGG - Intergenic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1061873869 9:133534510-133534532 CGCTCCTGGGCCGCCGCCGCCGG + Intronic
1062001020 9:134215668-134215690 GGTCCCTGAGCCTCACCCCCGGG + Intergenic
1062403715 9:136383632-136383654 GGGCCCTCCGCCGCCGCCTCCGG + Exonic
1062626038 9:137441841-137441863 GGTCCCGGGGCCGCCGCCGTCGG + Intergenic
1190322279 X:49186262-49186284 GGTCCCGGAGGCGCCGCTCCGGG - Exonic