ID: 1146794787

View in Genome Browser
Species Human (GRCh38)
Location 17:35773496-35773518
Sequence GTCAGACGAGGGGCTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146794787_1146794802 23 Left 1146794787 17:35773496-35773518 CCCCCAGCAGCCCCTCGTCTGAC 0: 1
1: 0
2: 2
3: 19
4: 235
Right 1146794802 17:35773542-35773564 GGGCAGCTCCCCCTTTGACTGGG 0: 1
1: 0
2: 0
3: 11
4: 152
1146794787_1146794797 2 Left 1146794787 17:35773496-35773518 CCCCCAGCAGCCCCTCGTCTGAC 0: 1
1: 0
2: 2
3: 19
4: 235
Right 1146794797 17:35773521-35773543 GGAAGACACAGTTTTTGCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 208
1146794787_1146794803 24 Left 1146794787 17:35773496-35773518 CCCCCAGCAGCCCCTCGTCTGAC 0: 1
1: 0
2: 2
3: 19
4: 235
Right 1146794803 17:35773543-35773565 GGCAGCTCCCCCTTTGACTGGGG 0: 1
1: 0
2: 0
3: 15
4: 179
1146794787_1146794801 22 Left 1146794787 17:35773496-35773518 CCCCCAGCAGCCCCTCGTCTGAC 0: 1
1: 0
2: 2
3: 19
4: 235
Right 1146794801 17:35773541-35773563 TGGGCAGCTCCCCCTTTGACTGG 0: 1
1: 0
2: 1
3: 9
4: 123
1146794787_1146794798 3 Left 1146794787 17:35773496-35773518 CCCCCAGCAGCCCCTCGTCTGAC 0: 1
1: 0
2: 2
3: 19
4: 235
Right 1146794798 17:35773522-35773544 GAAGACACAGTTTTTGCCCTGGG 0: 1
1: 0
2: 7
3: 31
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146794787 Original CRISPR GTCAGACGAGGGGCTGCTGG GGG (reversed) Intronic