ID: 1146797471

View in Genome Browser
Species Human (GRCh38)
Location 17:35793256-35793278
Sequence AGATGGAGAGAATTTCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 385}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146797471_1146797477 -4 Left 1146797471 17:35793256-35793278 CCAAGATGAAATTCTCTCCATCT 0: 1
1: 0
2: 1
3: 26
4: 385
Right 1146797477 17:35793275-35793297 ATCTGGGGCCACCACAGGCATGG 0: 1
1: 0
2: 3
3: 21
4: 228
1146797471_1146797475 -9 Left 1146797471 17:35793256-35793278 CCAAGATGAAATTCTCTCCATCT 0: 1
1: 0
2: 1
3: 26
4: 385
Right 1146797475 17:35793270-35793292 TCTCCATCTGGGGCCACCACAGG 0: 1
1: 0
2: 0
3: 45
4: 229
1146797471_1146797481 29 Left 1146797471 17:35793256-35793278 CCAAGATGAAATTCTCTCCATCT 0: 1
1: 0
2: 1
3: 26
4: 385
Right 1146797481 17:35793308-35793330 TATGCCTCTGTTCCCTTGCGAGG 0: 1
1: 0
2: 0
3: 8
4: 119
1146797471_1146797478 -3 Left 1146797471 17:35793256-35793278 CCAAGATGAAATTCTCTCCATCT 0: 1
1: 0
2: 1
3: 26
4: 385
Right 1146797478 17:35793276-35793298 TCTGGGGCCACCACAGGCATGGG 0: 1
1: 0
2: 2
3: 17
4: 235
1146797471_1146797482 30 Left 1146797471 17:35793256-35793278 CCAAGATGAAATTCTCTCCATCT 0: 1
1: 0
2: 1
3: 26
4: 385
Right 1146797482 17:35793309-35793331 ATGCCTCTGTTCCCTTGCGAGGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146797471 Original CRISPR AGATGGAGAGAATTTCATCT TGG (reversed) Intronic
900752869 1:4410092-4410114 GGTTGGTGAGAACTTCATCTTGG - Intergenic
901761882 1:11477173-11477195 AGGTGGTGAGAATTTCATCAAGG + Intergenic
902309249 1:15568369-15568391 AGAGGAAAAGATTTTCATCTAGG - Exonic
904720609 1:32504960-32504982 AGATGGAGATAACTGAATCTTGG + Intronic
909129482 1:71716227-71716249 AGTTGGAGATAATTTAATCATGG - Intronic
909418408 1:75434001-75434023 AGTTGGAGATAATTTAATCATGG - Intronic
910390777 1:86740943-86740965 AGATGGAGAAAATGTAATATGGG + Intronic
911054336 1:93697558-93697580 AGATGGGGAGACCTTCACCTGGG + Intronic
911307877 1:96253838-96253860 AAACAGACAGAATTTCATCTGGG + Intergenic
911474974 1:98363056-98363078 AGGTGGAGAGAATTGAATCATGG - Intergenic
911895417 1:103427598-103427620 AGATGGAGTCAATTAGATCTTGG - Intergenic
913043124 1:115049028-115049050 ACATGTATAGAAGTTCATCTGGG + Exonic
913558202 1:119991092-119991114 AAATGGAGAGAAATTAAACTTGG + Intronic
913639640 1:120799360-120799382 AAATGGAGAGAAATTAAACTTGG - Intergenic
914278808 1:146150583-146150605 AAATGGAGAGAAATTAAACTTGG + Intronic
914539855 1:148601525-148601547 AAATGGAGAGAAATTAAACTTGG + Intronic
914626791 1:149469695-149469717 AAATGGAGAGAAATTAAACTTGG - Intergenic
915875879 1:159611860-159611882 AGAAGGAGAGAAGTCCACCTAGG + Intergenic
916353825 1:163882035-163882057 ATATGGAGAGAATTGCAGATAGG - Intergenic
916642593 1:166746660-166746682 AGATGAAGTGAGTTTCTTCTAGG - Intergenic
917499860 1:175576307-175576329 AGGTGGAGAGAATTTGAGCAAGG + Intronic
917635368 1:176930561-176930583 ATCTGGACAGAATTACATCTGGG + Intronic
918480574 1:184973661-184973683 AGATGGGGAGAAACTCATTTAGG - Intronic
918607513 1:186446156-186446178 ACATACAGAGAATTCCATCTGGG - Intronic
919116422 1:193285702-193285724 AGATAAAGAGATTTTTATCTGGG - Intergenic
919300158 1:195752026-195752048 AGATGAAGTGAATGTGATCTTGG - Intergenic
921347982 1:214206793-214206815 AGATGGGGAGGATTCCATGTGGG - Intergenic
922406812 1:225322912-225322934 AGATGGAGAGACTATTTTCTAGG + Intronic
924076588 1:240345292-240345314 TCATGCTGAGAATTTCATCTTGG + Intronic
1063965494 10:11343214-11343236 AGATGGAAAGAATCACAGCTCGG - Intergenic
1064160109 10:12938049-12938071 AGATGGAGAGAATTCCATGTGGG - Intronic
1064267017 10:13833388-13833410 AGGTGGAGATAATTGCATCCTGG - Intronic
1064783324 10:18866680-18866702 AGTTGGAGGTAATTTGATCTTGG + Intergenic
1067272674 10:44805555-44805577 AGATGGATGGAATTACTTCTTGG + Intergenic
1067546955 10:47198924-47198946 AGAAGAAGAAAATTTCAACTGGG - Intergenic
1068278687 10:54838274-54838296 AGATGGAGATAATTGAATCATGG + Intronic
1068434273 10:56970530-56970552 AGATGGACAGATTTTTATTTAGG - Intergenic
1072289432 10:93949239-93949261 AGATGCTGAGAAGTTCAACTAGG + Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072491847 10:95914536-95914558 AGATGGAGGGAATTGGATCACGG + Intronic
1073164145 10:101429224-101429246 TGATGGATAAAATTTCATCCTGG + Intronic
1073195032 10:101683529-101683551 AGAGGGACAGAAATTAATCTAGG + Intronic
1073872754 10:107884649-107884671 ACATGGAGATAATTTAATCATGG + Intergenic
1074949544 10:118317670-118317692 AGATGTAAAGAAATTCATCCAGG + Intronic
1076207734 10:128616509-128616531 AGGTGGAGATAATTGAATCTTGG + Intergenic
1076608811 10:131707596-131707618 AGATGGTGAGAGCTTCATATGGG + Intergenic
1078303127 11:10155029-10155051 AGATAGAGAGCATTTAATTTTGG - Intronic
1078711968 11:13801446-13801468 AGGTGGAGATAATTTAATCAAGG - Intergenic
1079112501 11:17612714-17612736 GGACGGTGAGCATTTCATCTGGG - Exonic
1079945326 11:26733842-26733864 AGATGAAGATAATTGAATCTTGG + Intergenic
1080301670 11:30791456-30791478 ATTTGGAGAGCATTTCCTCTGGG + Intergenic
1080715524 11:34796504-34796526 AGAGGGAGATAATTTAATCATGG + Intergenic
1081163069 11:39775188-39775210 AGATGGAGATAATTGAATCATGG + Intergenic
1081234280 11:40627143-40627165 AAATGTAGACATTTTCATCTAGG + Intronic
1081628873 11:44673821-44673843 AGATGGAGATAATTGAATCATGG + Intergenic
1082860555 11:57851642-57851664 GGATGAAGCCAATTTCATCTTGG - Intergenic
1084491718 11:69482297-69482319 AGATGGAGATAATTGAATCATGG - Intergenic
1084508152 11:69583582-69583604 AAATGGAGAGAAATCCATCGAGG - Intergenic
1084794179 11:71493473-71493495 AGCTGGAGAGAATTTCTGCCAGG + Intronic
1085183047 11:74552241-74552263 AGGTGGAGATAATTTAATCATGG + Intronic
1085604009 11:77881119-77881141 AGAAGGAGACAAGATCATCTAGG + Intronic
1086269204 11:85039965-85039987 AGATGGAGAGAACACCATCTGGG + Intronic
1086773005 11:90792934-90792956 AGCTGGAGACTATTTCATGTTGG + Intergenic
1086968266 11:93052810-93052832 AAATGGATTGAATTTCATTTTGG + Intergenic
1087927364 11:103934757-103934779 AGATGGAGATAATTGAATCATGG - Intronic
1088226430 11:107625293-107625315 AGATGAAAAGTATTTCATTTGGG + Intronic
1088251176 11:107862065-107862087 AGATGGAGAGATTATCCTGTGGG + Intronic
1089947856 11:122496081-122496103 AGATGGAGATAATTGAATCATGG - Intergenic
1090090688 11:123694907-123694929 AGATTGACAGCATATCATCTAGG - Intergenic
1090106393 11:123857162-123857184 AGATGGAGATAATTGAATCATGG - Intergenic
1090757334 11:129803926-129803948 AGACAAAGAGAATTTAATCTTGG + Intergenic
1094412591 12:30182845-30182867 AGTTGGAGAGGAGTTCAGCTGGG + Intergenic
1096053771 12:48633880-48633902 AGATATAGAGAACTTCCTCTAGG - Intergenic
1096333504 12:50735242-50735264 ATCTGGAGATAATTTCAGCTTGG + Intronic
1096801505 12:54113487-54113509 AGATGCAGAGAAGTTCACCCAGG + Intergenic
1097587337 12:61530488-61530510 AGGTGGAGATAATTTAATCATGG - Intergenic
1098115266 12:67169198-67169220 AGATGGAGACAATTGAATCATGG - Intergenic
1098426746 12:70372892-70372914 GGATGAACAGAGTTTCATCTTGG + Intronic
1098741440 12:74178407-74178429 AGATGGAGATAATTGAATCATGG - Intergenic
1099975829 12:89544740-89544762 AGCTGAAGAGAATTTCATACAGG + Intergenic
1101225293 12:102682237-102682259 AGAAGATGAGAAGTTCATCTGGG - Intergenic
1101276517 12:103207723-103207745 AAATCCAGAGATTTTCATCTGGG + Intergenic
1101556060 12:105810796-105810818 AGATGAAGACAATATCTTCTAGG + Intergenic
1103241813 12:119419770-119419792 AGAAGGAGAGACTGTCATCTGGG - Intronic
1103450840 12:121027706-121027728 AGAAGACGAGAATTTCATGTTGG - Exonic
1103578979 12:121900110-121900132 AGAGGGAGAGGATCTCTTCTTGG + Intronic
1104263860 12:127212314-127212336 AGATGGAGATAAGTGAATCTTGG - Intergenic
1104489388 12:129180940-129180962 AGATTTAGAGAATTTCAACAGGG + Intronic
1104503429 12:129308033-129308055 AGATAGAGGGAATTTTACCTTGG - Intronic
1106493857 13:30256071-30256093 AGAAGCAGAGAAAATCATCTTGG - Intronic
1106706916 13:32290725-32290747 AGAAGGAGAGAGTTTGAACTGGG + Intronic
1106937625 13:34740375-34740397 AGTGGGAGATAATTTCATCATGG - Intergenic
1106955653 13:34935733-34935755 GGATAGAGAGAAATTCATGTTGG + Intergenic
1107983206 13:45753010-45753032 AGATGGAGATAATTGAATCATGG - Intergenic
1108789629 13:53951842-53951864 AGAAGGAAAGAATATCATCTCGG - Intergenic
1109786525 13:67182767-67182789 AGATGGATAAAATTTATTCTGGG + Intronic
1110970679 13:81757668-81757690 AGATGGAGATAATTGAATCATGG - Intergenic
1111060057 13:83005648-83005670 AGATGGAGAGAAGTTGCTGTTGG - Intergenic
1111394838 13:87651797-87651819 AGATGGAGAAAATCTACTCTGGG - Intergenic
1112123117 13:96434717-96434739 AGATAAAGATAATCTCATCTAGG - Intronic
1112582841 13:100691190-100691212 AGGTAGAGAGAATTTAATCACGG + Intergenic
1114177497 14:20336155-20336177 AGCTGAAGAGAATTTCATCATGG - Intergenic
1115473673 14:33794006-33794028 AAATGAAAAGAATATCATCTGGG + Exonic
1115879069 14:37894368-37894390 AAATGGAGACAATTACTTCTGGG + Intronic
1117290532 14:54327815-54327837 TTATGGATAGAGTTTCATCTGGG - Intergenic
1117842406 14:59873413-59873435 GGCTGGAAAGAATTTCATCTTGG - Intergenic
1117906951 14:60599878-60599900 AGCTGTAGAAAACTTCATCTTGG - Intergenic
1121379533 14:93451168-93451190 AGAAGGAGAGAAAATCAACTTGG - Intronic
1125108386 15:36001444-36001466 TGTTGGAAAGGATTTCATCTTGG + Intergenic
1125873745 15:43125731-43125753 ATTTGGGAAGAATTTCATCTAGG - Intronic
1126249470 15:46550969-46550991 AGATGGAGAAACTTCCATTTTGG + Intergenic
1126987564 15:54330371-54330393 AGAGGGTGAGCATTTCATATGGG + Intronic
1127954284 15:63839438-63839460 TCCTGGAGAGAATTTCATCCAGG + Intergenic
1128432684 15:67613529-67613551 AGATGCAGAGGATATCATCATGG - Intronic
1129786798 15:78315025-78315047 AAATGAAGACAATTTCTTCTTGG + Intergenic
1130292740 15:82618483-82618505 ATATGGAGAGATTTGGATCTAGG - Intronic
1131664596 15:94556922-94556944 AGTTGGAGAGAATTGAATCATGG - Intergenic
1131753205 15:95532113-95532135 AGATGGAGACATTTTCAACACGG + Intergenic
1132073155 15:98797518-98797540 AGATGGAGAGCTCTTCATTTGGG + Intronic
1132331162 15:101013301-101013323 AGGAGGAGAGAATTTAATGTGGG + Intronic
1132520888 16:388051-388073 AGATGGAGAGAAGGTCAGCAGGG + Intergenic
1132563224 16:608299-608321 AGATGGAGATAATTAAATCATGG - Intronic
1133803292 16:9102365-9102387 ATATGCAGAGAATTTAGTCTAGG + Intronic
1134026751 16:10959938-10959960 AGATGGACAGGGTGTCATCTTGG - Intronic
1135778931 16:25281880-25281902 ACATGGTGAGAACTTTATCTGGG - Intergenic
1135784039 16:25331972-25331994 AGGTGGAGAGAATTTAATTATGG + Intergenic
1135828775 16:25754745-25754767 AGGTGGAGATAATTTAATCATGG - Intronic
1139878012 16:70162068-70162090 AGAAAGAGAAAAGTTCATCTCGG + Exonic
1140203819 16:72916895-72916917 GGATGGAGTGAATGTGATCTTGG + Intronic
1140428647 16:74882964-74882986 AAATGGAAAGGATTTCATCTAGG - Intronic
1140602370 16:76492612-76492634 AGATGGAGATAATTGAATCATGG + Intronic
1142375295 16:89703513-89703535 AGGTGGAGATAATTAAATCTTGG + Intergenic
1144634023 17:16892672-16892694 AGATGGAGAGAATATACTCTGGG + Intergenic
1146164211 17:30575484-30575506 AGATGGAGAGAATACACTCTGGG + Intergenic
1146797471 17:35793256-35793278 AGATGGAGAGAATTTCATCTTGG - Intronic
1150240184 17:63624764-63624786 AGATGGAGAGAATTGTATGGGGG - Intronic
1150946219 17:69748856-69748878 AGATGGAGATAACTGAATCTTGG - Intergenic
1153995733 18:10440041-10440063 AGATGGAGGGAATTTCAAGTGGG + Intergenic
1154356152 18:13624497-13624519 AGATGGAGAGAATGGCAGCGGGG - Intronic
1156229250 18:35138029-35138051 AGCAGGAGAGAACTTCTTCTTGG - Intronic
1156737847 18:40283508-40283530 AGAAGGAGAGAATTTCAATAAGG + Intergenic
1157294836 18:46435092-46435114 AGATGAACAGCAGTTCATCTGGG + Intronic
1158181915 18:54725755-54725777 AGGTGGAGATAATTTAATCATGG - Intronic
1158733884 18:60057443-60057465 AGATGGAGATAATTGAATCATGG + Intergenic
1158806271 18:60977573-60977595 AGGTGGAGATAATTGCATCACGG + Intergenic
1159037675 18:63293238-63293260 AATTAGAGAGAATTTCATCCTGG - Intronic
1159718670 18:71858352-71858374 AGATGGAGATAATTGAATCATGG - Intergenic
1162002875 19:7758558-7758580 AGATGGAGACAATTGAATCATGG + Intergenic
1164239621 19:23373088-23373110 AGAGTGATAGAATGTCATCTGGG - Intronic
1165735136 19:38170884-38170906 GGCTGGAGAGACATTCATCTGGG + Intronic
1166968666 19:46547283-46547305 AGATGGAGATAATTGAATCATGG + Intronic
1166986430 19:46662375-46662397 AGATGGAGAGAAATTGATAGTGG + Intergenic
925019873 2:560134-560156 AGATGGAGACAAATACCTCTGGG - Intergenic
925456341 2:4019701-4019723 AGGTGGAGATAATTGCATCATGG - Intergenic
925503759 2:4536920-4536942 AGGTGGAAAGACTTTTATCTAGG - Intergenic
925676099 2:6362440-6362462 AGAGAGAGAGAATTTCATAGGGG - Intergenic
925678527 2:6391815-6391837 TGATGGAGAGGTTTTCTTCTGGG - Intergenic
925830859 2:7894283-7894305 AGATGGAGATAATTGAATCATGG + Intergenic
926280445 2:11441873-11441895 AGATGGAGAAAATTGAATCATGG - Intergenic
926327515 2:11797967-11797989 AGTTGGAGGGAATTGCATCATGG + Intronic
926544052 2:14216899-14216921 AGATGGAGATAATTGAATCAGGG + Intergenic
926612063 2:14956758-14956780 AGGTGGAGATAATTGAATCTTGG - Intergenic
927656852 2:24955597-24955619 AAATGAAGAGAATCACATCTTGG + Intronic
927675452 2:25102595-25102617 AGGTGGAGAGAATTGAATCATGG - Intronic
927769431 2:25846211-25846233 AGAGGGAGAGAAAATTATCTGGG + Intronic
928202078 2:29253983-29254005 AGATGGAGATAATTGAATCATGG + Intronic
928856038 2:35803576-35803598 ACAGGGAGAGAACTTCATCAAGG + Intergenic
928865253 2:35910005-35910027 AGATGGCCAGAAGTGCATCTTGG + Intergenic
929669626 2:43863276-43863298 AGATTGTGAGAATTCTATCTAGG - Intronic
931138702 2:59433366-59433388 AGATGGAGATAATTGAATCATGG + Intergenic
931949704 2:67349320-67349342 AGATGGAGATAATTGAATCATGG - Intergenic
931988445 2:67764376-67764398 AGATGGAGATAATTGAATCATGG + Intergenic
932952131 2:76305814-76305836 AGATGGAGATAATTGCATCACGG - Intergenic
934081900 2:88475722-88475744 AGATGGAGATAATTGAATCATGG + Intergenic
935740803 2:106146151-106146173 GGATAAAGGGAATTTCATCTGGG + Intronic
938855403 2:135305386-135305408 AGATGAAGTGAATTTCTTGTAGG + Intronic
939149928 2:138461140-138461162 AGGTGGAGATAATTTAATCATGG - Intergenic
939174924 2:138737448-138737470 AGATGGAGATAATTGAATCATGG - Intronic
939238156 2:139524159-139524181 AGATCTTGAGAACTTCATCTCGG - Intergenic
940495324 2:154420343-154420365 TAATGGAGACAAATTCATCTTGG - Intronic
940513205 2:154646274-154646296 ACATGCAGAGAATTTCATCATGG + Intergenic
941260541 2:163291554-163291576 AGGTGGAGAGAATTGAATCATGG + Intergenic
941724809 2:168849689-168849711 AGATGGGAAGAATTTTGTCTTGG + Intronic
943198460 2:184787134-184787156 AGATGAAGAGAATAACCTCTGGG - Intronic
944411224 2:199444668-199444690 AGGAGGAAAGAATTTCATCTGGG + Intronic
944818857 2:203408713-203408735 AGAAGAGGAGCATTTCATCTTGG + Intronic
944926984 2:204475508-204475530 ACATTTAGATAATTTCATCTGGG + Intergenic
945268348 2:207913451-207913473 GGAAGGAGAGAATTTCATGAAGG + Intronic
945357992 2:208861207-208861229 AGATGGAGATAATTGGATCATGG + Intergenic
945918218 2:215727260-215727282 AGATGCAGAGAATTGGCTCTTGG - Intergenic
946100423 2:217315755-217315777 AGTTGGAGAGGAGTTCAGCTGGG + Intronic
946280076 2:218660079-218660101 AGATGGGCAGATTTTCATTTGGG + Exonic
946826399 2:223682796-223682818 AGATGGAGATAATTGAATCATGG - Intergenic
947334423 2:229067218-229067240 AGGTGGAGATAATTTAATCATGG - Intronic
947860258 2:233353442-233353464 AGATGGACAGCATTTCCTCTGGG + Intergenic
947966199 2:234283450-234283472 AGATGGAGATAATTGAATCATGG + Intergenic
947973756 2:234346259-234346281 AGCTGGAGAGAATGGCCTCTTGG + Intergenic
948344215 2:237281675-237281697 AGATGCAGATAATTTCCTTTAGG - Intergenic
1169625609 20:7565136-7565158 AGATGTAAAGAAACTCATCTAGG + Intergenic
1170870649 20:20202963-20202985 GGATAGAAAGCATTTCATCTCGG + Intronic
1170875603 20:20247191-20247213 AAATGGAGAGAATGTGTTCTTGG - Intronic
1171199214 20:23227582-23227604 AGACTGAGAGAATTCTATCTTGG + Intergenic
1171853265 20:30323286-30323308 AGATGCAGAGAAGTTCACCCAGG + Intergenic
1172623211 20:36332965-36332987 AGAGGGTGAGAATTTGCTCTTGG - Intronic
1173398404 20:42702293-42702315 AGATGAAGAGAATACCTTCTGGG - Intronic
1174491557 20:50901162-50901184 AGAAGCAGAGTATTTCATCATGG - Intronic
1175416344 20:58803921-58803943 AAATGGAAAGAAGTTCACCTGGG - Intergenic
1176697773 21:10001450-10001472 AGGTAGAGAGAATTTAATCATGG - Intergenic
1178361442 21:31951767-31951789 AGAGTGAGAGAATTTGTTCTAGG + Intronic
1178557257 21:33603593-33603615 AGATGGAGAGAAATAGATCCAGG - Intronic
1184028892 22:41879312-41879334 AGATGGAGTGGACTCCATCTAGG + Intronic
1185390221 22:50556292-50556314 AGATGGAGAAAATCTCAGGTAGG - Exonic
950270190 3:11608293-11608315 ACATGAAGATAATTTTATCTAGG + Intronic
951221058 3:20069407-20069429 AGAAGGACAGAAGTTGATCTTGG - Intronic
951328780 3:21339659-21339681 AGATGAAGTGAGTTTCATGTAGG + Intergenic
952504394 3:33995050-33995072 AGATGGAGATAATTGAATCTTGG - Intergenic
954787467 3:53104818-53104840 AGAAGAAGAGATTTTAATCTAGG - Intronic
955487735 3:59451715-59451737 AGATGGAGTGCATTTCATGCAGG + Intergenic
955900368 3:63747371-63747393 AGATGGAGATAATTGAATCGTGG - Intergenic
956293439 3:67686248-67686270 AGATGGAGATAATTGCATCATGG + Intergenic
956553566 3:70490700-70490722 AGATGGAGACTATTTTATCCCGG - Intergenic
956945325 3:74215353-74215375 AGATGGAGATAATTGAATCATGG + Intergenic
957382872 3:79456606-79456628 AGATAGAGAAAACTTCATGTTGG - Intronic
957410999 3:79839962-79839984 AGGTGGAGATAATTTAATCATGG - Intergenic
957658192 3:83110256-83110278 AGATGAAGCCAATTTGATCTTGG - Intergenic
958090324 3:88869363-88869385 AGGTGGAGATAATTGTATCTTGG - Intergenic
958194716 3:90229520-90229542 AGATAAAGAGAATTTCACTTTGG - Intergenic
958196142 3:90244663-90244685 AGATGGAGATAATTGAATCATGG + Intergenic
958418064 3:93900480-93900502 AGATAAAGAGAATTTCACTTTGG - Intronic
960143725 3:114176212-114176234 AGATGAAGACAACTACATCTGGG + Intronic
960847192 3:122015480-122015502 AGGTGGAGATAATTGAATCTTGG + Intronic
961076657 3:123989123-123989145 GTAAGGAGAGAATTTCATGTAGG + Intronic
961134867 3:124501110-124501132 AGATGGAGAGTATCCCAACTAGG - Intronic
963372788 3:144422899-144422921 AGATTGAAAGAGTCTCATCTAGG + Intergenic
963838467 3:150080361-150080383 AGATGTAGTGAATTTCCCCTTGG - Intergenic
964043774 3:152297021-152297043 AGATGGGGATAATGACATCTTGG + Intronic
964573493 3:158138445-158138467 AGATTGAGAGAATTCTATGTGGG + Intronic
964698228 3:159534209-159534231 AGAAGTAGAGAATTTTATCTTGG - Intronic
964880622 3:161419157-161419179 AGATGGAGAAAACTCCATCTTGG - Intergenic
964972389 3:162577981-162578003 AAATGGAAAGAACTTCTTCTGGG + Intergenic
965243508 3:166233281-166233303 AGATCTAGAGAATTTCCACTTGG + Intergenic
969050091 4:4366575-4366597 AGGTGGAGATAATTGCATCATGG + Intronic
969783868 4:9436191-9436213 AGATGGAGATAACTTAATCATGG - Intergenic
970041425 4:11801384-11801406 AGATGGAGATAATTCAATCACGG - Intergenic
970156507 4:13147390-13147412 AGATGGAAGGAACGTCATCTAGG + Intergenic
970367408 4:15373745-15373767 ATATGGAGAAAATTTTACCTTGG - Intronic
970987124 4:22171627-22171649 AGGTGGAGAGAATTGAATCATGG - Intergenic
971365221 4:25971787-25971809 AGAAGGAGAGAATGTCATCCTGG + Intergenic
971366330 4:25980167-25980189 AGATGGAAATAATTTCTTCCTGG + Intergenic
971495760 4:27263552-27263574 AGCTGGAGATAATTGCATCATGG + Intergenic
972246715 4:37252703-37252725 AGATGGAGAGAATACCCTCATGG - Intronic
972300605 4:37782245-37782267 AAGTGGAGAGGATTTCTTCTTGG - Intergenic
972940579 4:44190416-44190438 AGATGGAGTAAATTTCTTATTGG + Intronic
973986012 4:56354101-56354123 AGATGGAGAGATTTTTTTTTTGG - Exonic
974373405 4:61045722-61045744 AGATGGAGATAATTGAATCATGG - Intergenic
976528972 4:86128364-86128386 AGATGGAGGTAATTTAATCATGG + Intronic
976952270 4:90848744-90848766 AGGTGGAGATAATTGAATCTTGG + Intronic
977579189 4:98705664-98705686 AGTTGGAGATAATTTAATCATGG + Intergenic
977731053 4:100352597-100352619 AGGTGGAGATAATTGCATCATGG - Intergenic
977821246 4:101474524-101474546 AGATGCAGAGAATTTAATGCAGG - Intronic
978712582 4:111802822-111802844 AGATGGAGATAATTGAATCACGG - Intergenic
978829945 4:113072030-113072052 AGATGGAGATAATTGAATCAAGG - Intronic
979644328 4:123050700-123050722 AGGTGAAGAGAGTTTCTTCTAGG + Intronic
980740898 4:136948813-136948835 AGATTTTGAGAATTTCATTTTGG + Intergenic
981285617 4:143015612-143015634 AGATGGAGATAATTGAATCATGG - Intergenic
981760707 4:148192181-148192203 AGAGGGAGAGTAGTTCATCAAGG - Intronic
982084845 4:151823997-151824019 AGATGCATAGAATTTCCTATGGG - Intergenic
982104039 4:151996351-151996373 AGATGGGTAGAATCTCATCTAGG + Intergenic
982124374 4:152171728-152171750 AGATGGAGATAATTGAATCATGG + Intergenic
982243945 4:153330197-153330219 AGATGGAGATGATTTCACCATGG + Intronic
982381685 4:154755719-154755741 AGATGGAGAGTGTTTCATATAGG + Intergenic
983473878 4:168191211-168191233 ATATGGAAAGCATTTCATCCAGG + Intergenic
984164128 4:176287433-176287455 AGATCAAGTGAATTTCATTTTGG - Intergenic
984544544 4:181086108-181086130 AAATAGAGACAATTTCATTTTGG - Intergenic
985229158 4:187796548-187796570 AGAAGGAGAGCACTTCATCATGG + Intergenic
985835940 5:2272013-2272035 AAATGGAGAGTTTTCCATCTCGG + Intergenic
986204122 5:5607461-5607483 AGGTGGAGATAATTTAATCATGG - Intergenic
987002327 5:13672368-13672390 AGGTGGAGATAATTAAATCTTGG - Intergenic
987268267 5:16278600-16278622 ACATTGAGAGAAGTTCAGCTGGG + Intergenic
988076002 5:26355665-26355687 AGTTAGAGAAAATTTCCTCTAGG + Intergenic
988643293 5:33065704-33065726 GCATGGAGGGAATCTCATCTTGG + Intergenic
988937750 5:36106015-36106037 AGATGAAGAGATTTGCATTTGGG - Intronic
990289699 5:54336191-54336213 AGATGAAGTGAATTTCCTGTAGG - Intergenic
990521347 5:56584331-56584353 AGATTGAGTGAATTTCAAGTAGG - Intronic
991469176 5:66949335-66949357 AGGTGGAGATAATTGCATCATGG + Intronic
993990919 5:94657941-94657963 AGGTGGAGAGAGTTTCTTATAGG + Intronic
995370284 5:111410386-111410408 AGGTGGAGATAATTGAATCTTGG - Intronic
995925672 5:117370209-117370231 AGATGGAGATAATTGAATCATGG + Intergenic
996144066 5:119951833-119951855 AGAGGGAGAGAATTAAAACTAGG - Intergenic
996144953 5:119962947-119962969 ATATGAAGAGAATTTAATGTTGG - Intergenic
996692564 5:126356228-126356250 AGGTGGAGATAATTGAATCTTGG - Intergenic
996721855 5:126638052-126638074 ATATGTACAGAATTTCATATTGG + Intergenic
997318154 5:132955106-132955128 GGTTGGAGAGGATTTCAGCTAGG - Intronic
998634605 5:143939560-143939582 AGATGGAGATAATTGAATCATGG - Intergenic
998696976 5:144652001-144652023 AGGTGGAGATAATTTAATCATGG - Intergenic
999127128 5:149254091-149254113 AGGTGGAGATAATTGAATCTTGG - Intronic
999175816 5:149630976-149630998 ACATTGAGAGAATTTCATGAAGG - Intronic
999775890 5:154812894-154812916 AGGTGGAGATAATTGCATCATGG - Intronic
1000744690 5:165018284-165018306 CTATGGAGAGAATGACATCTTGG + Intergenic
1001278898 5:170371770-170371792 AGATGGAGCCACTTTCATTTGGG - Intronic
1001355172 5:171014270-171014292 AAAGGTAGAGATTTTCATCTAGG - Intronic
1002365086 5:178703476-178703498 AAAGGGAGTGAATTTCATCATGG + Intergenic
1002932567 6:1644521-1644543 AAGTGGAGAGAATTTCAGCTGGG - Intronic
1002934893 6:1663193-1663215 AAAGGGAGAGAAATTCAACTTGG + Intronic
1002972208 6:2035317-2035339 AAATGGAGAGAAGGGCATCTAGG - Intronic
1005629034 6:27690267-27690289 AGATGGAGTGGCTTTCAGCTGGG - Intergenic
1007074927 6:39060356-39060378 ATTTGGAGAGAATTTAATGTTGG + Intronic
1007251462 6:40497972-40497994 AGAAGGAGAGAATCACTTCTGGG + Intronic
1010629761 6:78184641-78184663 AGATGGATAGATTTACTTCTGGG + Intergenic
1010791721 6:80072812-80072834 AGATGAAGTGAATTTCTTGTAGG + Intergenic
1011827546 6:91328135-91328157 TGCAGGAGAGTATTTCATCTGGG + Intergenic
1011938909 6:92818044-92818066 AAATGGAAAGAATTGCATTTGGG - Intergenic
1012029323 6:94037843-94037865 AGATGGAGATAATTGAATCATGG + Intergenic
1012478056 6:99636641-99636663 AGATGGAGATAATTGAATCATGG - Intergenic
1012592540 6:101000255-101000277 AGATGGAGAAAATGCCATGTTGG - Intergenic
1013340645 6:109211953-109211975 AGATGAAGTGAGTTTCTTCTAGG + Intergenic
1014066985 6:117138566-117138588 GGATGGAAAGAATATCAGCTAGG + Intergenic
1015217967 6:130771828-130771850 AAATGGTAAGAATTTCATTTTGG - Intergenic
1016868008 6:148788224-148788246 AGAGGGAGACAATTGAATCTTGG - Intronic
1017359821 6:153554545-153554567 AGATGGAGATAATTGAATCATGG - Intergenic
1017837373 6:158190935-158190957 AGAGGGATACAATTTCTTCTCGG - Intronic
1017952140 6:159144155-159144177 AGATGGAGATAATTGAATCAAGG - Intergenic
1018386404 6:163308053-163308075 AAATGGTGACAATTTAATCTAGG + Intronic
1018594678 6:165465764-165465786 AGATGGAGATAATTGAATCATGG - Intronic
1019124677 6:169830363-169830385 AGATGGAGAAAAGTTCAGCCTGG - Intergenic
1020835257 7:13141604-13141626 AGAAGGTGAGAAATTCATCAAGG + Intergenic
1021595722 7:22314454-22314476 AGATGGAAAAAATTTTATCATGG - Intronic
1022555859 7:31295214-31295236 AGGTGGAGAGAATATCTTCATGG + Intergenic
1023956258 7:44889269-44889291 AGATGGTGAGAAGTTCAGTTTGG + Intergenic
1024097329 7:45993182-45993204 GGATGGATATAATTTCATTTGGG + Intergenic
1024125768 7:46293130-46293152 ACATGGCTAGAATTTCATGTTGG + Intergenic
1024844083 7:53621327-53621349 AGATGGAGATAATTGAATCGGGG + Intergenic
1026562099 7:71458764-71458786 ACATGGAGAGGAGTTCAGCTGGG - Intronic
1027444972 7:78263397-78263419 AGATGGTAAGAATCTCATCTTGG - Intronic
1028402549 7:90439838-90439860 AGGTGGAGATAATTTAATCATGG - Intronic
1030476551 7:110041368-110041390 AGATGAAGGGTATTTCTTCTAGG + Intergenic
1030830005 7:114209088-114209110 AGATGGAGATAATTGAATCATGG + Intronic
1032740279 7:134731573-134731595 AGAGGGTGAGAATTTCATAGCGG - Intergenic
1033535004 7:142304015-142304037 AAAGGGAGAGAATTTGAGCTGGG + Intergenic
1034288806 7:149910987-149911009 AGCTGGAGAGGACTTCACCTGGG - Intergenic
1034733787 7:153411120-153411142 TGATGGAGAGAGTTTCAGTTTGG + Intergenic
1034869579 7:154672069-154672091 AGATGGAGATAATTGAATCATGG + Intronic
1036489544 8:9212228-9212250 AGATGGAGATAATTGAATCATGG - Intergenic
1036835176 8:12057926-12057948 AGATGGAGATAACTTAATCATGG + Intergenic
1036857019 8:12304490-12304512 AGATGGAGATAACTTAATCATGG + Intergenic
1037746791 8:21651846-21651868 AGAAAGAGAGAATTTCAGATGGG - Intergenic
1037848155 8:22303003-22303025 AGATAGAGAAAACTTAATCTAGG - Intronic
1038364258 8:26915037-26915059 AGGTGGAGATAATTGCATCATGG - Intergenic
1038416981 8:27404307-27404329 AGAAGCAGAGATATTCATCTGGG + Intronic
1039015690 8:33146543-33146565 AGATGGAGATAATTGAATCATGG - Intergenic
1039171319 8:34749248-34749270 AGATGTAGAGACTTTCATGAAGG + Intergenic
1040835160 8:51723544-51723566 AAATGGAGAGAAGTTCATCAAGG + Intronic
1041888958 8:62846995-62847017 AGATGGAGATAATTGAATCACGG - Intronic
1042387052 8:68188762-68188784 AGATGGAGATAATTGAATCATGG - Intronic
1042685710 8:71438121-71438143 AGATGGTAAGGAATTCATCTAGG - Intronic
1044465617 8:92500243-92500265 AGATGGAGAGAGCTGCACCTTGG + Intergenic
1045314513 8:101031445-101031467 AGGTGGAGAGAATTGAATCATGG + Intergenic
1045896472 8:107224828-107224850 AGGTGGAGATAATTTAATCATGG + Intergenic
1046038578 8:108874714-108874736 AGATGGAGATAATTGAATCATGG - Intergenic
1046065827 8:109195805-109195827 AGATGGAGATAATTGAATCATGG - Intergenic
1046349587 8:112989901-112989923 AGATGGAGATAATTGAATCATGG + Intronic
1046442501 8:114276957-114276979 AGATGAAGGGCATTTCTTCTTGG - Intergenic
1046506884 8:115147818-115147840 AGATGGAGATAATTGAATCATGG - Intergenic
1046640031 8:116719458-116719480 AAATGGAGAGAATGTAATATGGG + Intronic
1048416942 8:134236652-134236674 AGGTGGAGATAATTTTATCATGG - Intergenic
1048592399 8:135832962-135832984 AGCAAGAGAGAATTTCATTTTGG - Intergenic
1050866339 9:10504836-10504858 AGTAAGAGATAATTTCATCTTGG - Intronic
1052261370 9:26520100-26520122 AGATGTAGAAAATTAAATCTGGG - Intergenic
1053634896 9:39987814-39987836 AGGTAGAGAGAATTTAATCATGG - Intergenic
1053771029 9:41476520-41476542 AGGTAGAGAGAATTTAATCATGG + Intergenic
1053791061 9:41686585-41686607 AGATGCAGAGAAGTTCACCCAGG + Intergenic
1054154092 9:61628187-61628209 AGATGCAGAGAAGTTCACCCAGG - Intergenic
1054179407 9:61898279-61898301 AGATGCAGAGAAGTTCACCCAGG + Intergenic
1054208991 9:62262883-62262905 AGGTAGAGAGAATTTAATCATGG + Intergenic
1054473877 9:65559307-65559329 AGATGCAGAGAAGTTCACCCAGG - Intergenic
1054549764 9:66388325-66388347 AGGTAGAGAGAATTTAATCATGG + Intergenic
1054658131 9:67682542-67682564 AGATGCAGAGAAGTTCACCCAGG - Intergenic
1055225632 9:73991044-73991066 AGGTGGAGATAATTTAATCATGG - Intergenic
1055252139 9:74320548-74320570 AGATGGAGACAATTGAATCATGG + Intergenic
1055687624 9:78794232-78794254 AGATGGAGATAATTGAATCATGG - Intergenic
1056147260 9:83744959-83744981 AGATGGAGATAATTGAATCATGG - Intronic
1056224899 9:84485099-84485121 AGATGGAGAAACGTTCGTCTTGG + Intergenic
1056698960 9:88886617-88886639 AGAGGGAGAGTACTACATCTAGG - Intergenic
1057792453 9:98133127-98133149 ACATGGAGAGGATCACATCTTGG + Exonic
1058364077 9:104187101-104187123 AGATTTAGAGAATTTCCTTTAGG + Intergenic
1059225451 9:112668783-112668805 AGATGGAGACAATCTCTTCTGGG + Intronic
1059529131 9:115019511-115019533 AGAAGGAGAGATTTTCATTAAGG + Intergenic
1060427798 9:123521128-123521150 AGCTGGATGAAATTTCATCTGGG - Intronic
1185815405 X:3150525-3150547 AAATGGAGTGAATTTCCTATGGG + Intergenic
1186019070 X:5234048-5234070 AAATAGAGAGAATTTCATTTTGG - Intergenic
1186031281 X:5372072-5372094 AGAGAGAGAGAATTTGACCTGGG - Intergenic
1186406148 X:9305160-9305182 ACACGGTAAGAATTTCATCTTGG - Intergenic
1186595124 X:10972874-10972896 AGAGGGAGAGAATTTGAGGTTGG - Intergenic
1187515878 X:19969490-19969512 AGATGAAAACAATTTTATCTGGG - Intronic
1187896194 X:23981838-23981860 AAATGGAGGGAAATTCCTCTGGG + Intergenic
1187967461 X:24626568-24626590 AGATGCAGAAAATTTAATCAAGG + Intronic
1188364300 X:29295737-29295759 TGATGGACAGAGTTTCATCTTGG - Intronic
1188975705 X:36672303-36672325 TGATGGTGAGAATTTCCACTGGG + Intergenic
1189277631 X:39798296-39798318 AGATGGAAAGCCTTCCATCTAGG - Intergenic
1193183466 X:78485069-78485091 ACTTGGAGAGAAATTGATCTTGG - Intergenic
1193832350 X:86304722-86304744 AGATGGAGAGAAAGTCAGATGGG + Intronic
1194106871 X:89780381-89780403 AGATGGAGATAATTGAATCATGG - Intergenic
1194349853 X:92812677-92812699 AGCTCTAGAGAATTTCCTCTTGG - Intergenic
1195022991 X:100848161-100848183 AGACCGAGGAAATTTCATCTGGG - Intronic
1196173499 X:112615879-112615901 AGCTGGAGAAAATTTAATCGTGG + Intergenic
1196313651 X:114197657-114197679 AGATGGAGATAATTGAATCATGG - Intergenic
1197643855 X:128996026-128996048 AGGTGGAGATAATTGAATCTTGG + Intergenic
1198527865 X:137520260-137520282 AGAAGTAGAGTATTTCAGCTTGG - Intergenic
1199226423 X:145380287-145380309 AGGTGGAGAGAATTGAATCACGG + Intergenic
1199666157 X:150098160-150098182 TGATCTAGAGAATTTCCTCTAGG + Intergenic
1200041550 X:153374443-153374465 AGAGGGAGAGATTTTCCACTGGG + Intergenic
1200458833 Y:3428246-3428268 AGATGGAGATAATTGAATCATGG - Intergenic
1200658173 Y:5929285-5929307 AGCTCTAGAGAATTTCCTCTTGG - Intergenic