ID: 1146797937

View in Genome Browser
Species Human (GRCh38)
Location 17:35795700-35795722
Sequence ACCGCCTCGCGTTCCAGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146797937 Original CRISPR ACCGCCTCGCGTTCCAGCAG CGG (reversed) Intronic
904171108 1:28592666-28592688 ACCGCCGCGCGCTGCAGCTGCGG + Intronic
912078713 1:105910438-105910460 ACCTCCTCCCATTCCAGCTGGGG + Intergenic
912094572 1:106121917-106121939 ACAGCCATGTGTTCCAGCAGGGG - Intergenic
918962305 1:191296923-191296945 ACTTGCTCGGGTTCCAGCAGTGG + Intergenic
923490340 1:234478610-234478632 CCCGCCACGCGCTCCAGTAGCGG + Exonic
1084192490 11:67505270-67505292 CCGGCCTCGGGTTCCAGCGGTGG + Exonic
1088579808 11:111303725-111303747 ACTGCCTCCTGTTTCAGCAGTGG + Intronic
1092344753 12:7706022-7706044 CCCGCCTTGCATTCCTGCAGTGG - Intergenic
1095823013 12:46500037-46500059 ACCACCTTGCGTTCCACCAGTGG + Intergenic
1106081026 13:26500556-26500578 ACTGCCTGGCATTTCAGCAGAGG + Intergenic
1120935489 14:89891942-89891964 ACCGCCGCGCGCTGCAGCTGCGG + Intronic
1122746677 14:103901213-103901235 ACCGGCGCGCTGTCCAGCAGGGG + Intergenic
1132155973 15:99495462-99495484 ACGGCCTCCCTTACCAGCAGGGG + Intergenic
1139375410 16:66493619-66493641 ACCGCCTCAGGGTGCAGCAGGGG + Intronic
1142079121 16:88138953-88138975 ACAGCCTAGCGTTTCACCAGAGG - Intergenic
1142120207 16:88383299-88383321 CCCGCCCCGCGTTCCAGCCCGGG - Intergenic
1143467087 17:7144548-7144570 ACCGCATCTTGTTTCAGCAGCGG + Intergenic
1146797937 17:35795700-35795722 ACCGCCTCGCGTTCCAGCAGCGG - Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1164484393 19:28642402-28642424 TCAGCCTCGCGCTGCAGCAGAGG + Intergenic
927757652 2:25722163-25722185 ACCTCCTCGCTTTCCTTCAGAGG - Intergenic
937241635 2:120465868-120465890 AGCTCCTGGCATTCCAGCAGGGG - Intergenic
1169513723 20:6294202-6294224 ACTGCATACCGTTCCAGCAGTGG - Intergenic
1173844065 20:46177072-46177094 ACCTCCTCAGGTCCCAGCAGAGG - Intronic
1175714683 20:61247481-61247503 AGCGGCTCCCGCTCCAGCAGAGG + Intergenic
1178478087 21:32955557-32955579 AGCCCCTGGTGTTCCAGCAGAGG - Intergenic
1178849354 21:36200344-36200366 ACCGCCGCGTGTGCCAGGAGAGG - Exonic
968067247 3:195765376-195765398 ACCGTCTCGAGTGCCTGCAGTGG - Exonic
968629724 4:1644025-1644047 ACCTCCACGCCATCCAGCAGGGG - Intronic
1004551581 6:16653251-16653273 TCCGCCTCTTGTTCCAGCAAGGG - Intronic
1014632433 6:123803546-123803568 TCCGCGCCGCGTCCCAGCAGCGG - Intergenic
1018972514 6:168538693-168538715 TCCCCCTCACATTCCAGCAGCGG - Intronic
1019577832 7:1746055-1746077 ACGGCCTCGGGGCCCAGCAGCGG - Exonic
1021732285 7:23607757-23607779 AACGACTCAGGTTCCAGCAGAGG + Intronic
1026360294 7:69597559-69597581 CCCGCCTCGTCTTCCAGCGGGGG - Intergenic
1035240018 7:157523476-157523498 ACCGTCCCACTTTCCAGCAGAGG + Intergenic
1060846121 9:126838962-126838984 ACCGCCAAGCGTGCCAGCCGCGG - Intergenic
1192631784 X:72782718-72782740 ACAGCCTTGTGCTCCAGCAGGGG + Intronic
1192635086 X:72808269-72808291 ACAGCCTGGTGCTCCAGCAGGGG + Intronic
1192646629 X:72912534-72912556 ACAGCCTGGTGCTCCAGCAGGGG - Intronic
1192649925 X:72938083-72938105 ACAGCCTTGTGCTCCAGCAGGGG - Intronic