ID: 1146799178

View in Genome Browser
Species Human (GRCh38)
Location 17:35805085-35805107
Sequence GACTATAAGCTGTAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146799172_1146799178 22 Left 1146799172 17:35805040-35805062 CCAAGCAGGGGATGGAGGCAACT 0: 1
1: 0
2: 1
3: 29
4: 192
Right 1146799178 17:35805085-35805107 GACTATAAGCTGTAGGTGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146799178 Original CRISPR GACTATAAGCTGTAGGTGGG GGG Intronic
904172178 1:28599114-28599136 GATTTTATGCTGTAGGTGTGGGG - Intronic
906968687 1:50486720-50486742 GACATTATGCTGTAGGTGCGAGG - Intronic
907556951 1:55352435-55352457 GACTCTGGGCTGGAGGTGGGGGG + Intergenic
909155693 1:72072860-72072882 GACTATTATCTGTATGTGGATGG - Intronic
910218428 1:84865234-84865256 GAGTGTAAGCTCCAGGTGGGTGG + Intronic
911182802 1:94876062-94876084 CACAATAACCTGTGGGTGGGAGG - Intronic
912472888 1:109917681-109917703 GACTATAAGCTGCATGGGGTGGG - Intronic
916955795 1:169833256-169833278 GACTCTAATCTGTGGATGGGTGG + Intronic
921960953 1:221033945-221033967 GACAGTAAGCTGGAGGTGGAGGG + Intergenic
923841128 1:237671448-237671470 GCCGATAAGAGGTAGGTGGGAGG + Intronic
924408559 1:243778138-243778160 GACTATAAGCTGTTTGAGGCAGG + Intronic
924858883 1:247900970-247900992 GACTGTGAGCTGTATGTGGATGG - Intergenic
1062832093 10:612580-612602 GAATATAAGATGCAGATGGGAGG - Intronic
1062996629 10:1872453-1872475 AACTAAAAGCTGTAGCTGTGAGG + Intergenic
1066472434 10:35712162-35712184 GACTCTAGGCTTAAGGTGGGCGG - Intergenic
1066981721 10:42422767-42422789 GACAGTAAGCTATAGTTGGGAGG - Intergenic
1070615504 10:77966639-77966661 GAATCACAGCTGTAGGTGGGGGG - Intergenic
1072167824 10:92830809-92830831 GAGTTTGAGCTGCAGGTGGGAGG + Intergenic
1074719102 10:116249200-116249222 GACTATAAGCTCCATGGGGGAGG + Intronic
1076792562 10:132785064-132785086 GCCGAGAAGCTGAAGGTGGGCGG - Exonic
1077043376 11:534294-534316 GAATATAAGCTGGTGGTGGTGGG - Exonic
1079126984 11:17724135-17724157 GATTTTAAGCTGTAGGAAGGTGG - Intergenic
1080632665 11:34093371-34093393 GCCTATAAGGTAGAGGTGGGAGG - Intronic
1080792581 11:35535056-35535078 GAGTGCAAGCTGAAGGTGGGTGG + Intergenic
1082115478 11:48323789-48323811 GACAATAAGAAGTAGGTGGTCGG + Intergenic
1082258188 11:50055526-50055548 GACAATAAGAAGTAGGTGGTCGG - Intergenic
1083932065 11:65851484-65851506 TACTGTCAGCTCTAGGTGGGAGG + Intronic
1084424868 11:69079113-69079135 GACTAGAGGCTGTAGGAAGGTGG + Intronic
1086421055 11:86637672-86637694 AACTTTGTGCTGTAGGTGGGAGG + Intronic
1086544921 11:87956873-87956895 GATAATAAACTGAAGGTGGGGGG - Intergenic
1088271086 11:108035226-108035248 TACCAAAAGCTGTAGTTGGGAGG - Intronic
1088502588 11:110497507-110497529 GACTTCAGGCTGTATGTGGGAGG - Intergenic
1089768671 11:120786804-120786826 AAATATTTGCTGTAGGTGGGGGG - Intronic
1092972759 12:13713824-13713846 GACTAAAAGCTCTAAGTGGTTGG - Intronic
1095576839 12:43749885-43749907 GTCTATAAGAGGTAGGAGGGAGG + Intronic
1095907007 12:47388959-47388981 GACTACAAGGTGTAGGTGCTGGG - Intergenic
1103826029 12:123739281-123739303 GACTATAAGCAGTAAGAGGTGGG - Intronic
1104011098 12:124930765-124930787 CACTAGAAGCTGGGGGTGGGAGG - Intergenic
1106368501 13:29107257-29107279 GACTATAAGCTCTTAGGGGGTGG + Intronic
1107238129 13:38197814-38197836 GACTACAAACTGTAGGTGAAAGG - Intergenic
1108329184 13:49367839-49367861 GCCTAGAAGGTGTAGGTGGAAGG + Intronic
1108569741 13:51737504-51737526 GAATAGAAGCTCTAGGAGGGCGG - Intronic
1109303686 13:60615758-60615780 CACTAAAAGCTGTAGGTGAAGGG + Intergenic
1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG + Intergenic
1110749984 13:79102017-79102039 GTCTATAAGTTGTAGCTGGAGGG - Intergenic
1112423810 13:99277834-99277856 GCCTCTAATCTGGAGGTGGGTGG + Intronic
1118691829 14:68347383-68347405 GACTTTAAGAAGTAGGTGGCTGG + Intronic
1119709465 14:76811502-76811524 TACTGTAATGTGTAGGTGGGGGG + Intronic
1120471416 14:84929916-84929938 GACTGCAAGTTGTAGGTGCGAGG - Intergenic
1124165936 15:27325645-27325667 GAATATAAGCTCTAGGAGGGAGG + Intronic
1129324731 15:74794100-74794122 GACTGTAAGCTGTGGGGGTGGGG - Intronic
1129324788 15:74794265-74794287 GACTGTAAGCTGTGGGGGTGGGG - Intronic
1129324809 15:74794320-74794342 GACTGTAAGCTGTGGGGGTGGGG - Intronic
1131794603 15:96002421-96002443 GACTATAATTTGTACGTGGGGGG - Intergenic
1133040135 16:3056266-3056288 GACTATAGACTGTAGCTGGGAGG + Intronic
1134538697 16:15047067-15047089 AACTACAAGGTGTAGGTGAGAGG + Intronic
1140859282 16:79005223-79005245 GAAACTTAGCTGTAGGTGGGTGG - Intronic
1144458422 17:15437590-15437612 GAATGCAAGCTGTAGGTGGGTGG - Exonic
1146799178 17:35805085-35805107 GACTATAAGCTGTAGGTGGGGGG + Intronic
1148786027 17:50146602-50146624 GACTAGAAGGCTTAGGTGGGAGG + Intronic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1153550603 18:6258177-6258199 GACTGAAAGCTTCAGGTGGGAGG + Intronic
1154013953 18:10600025-10600047 GACTAGGAGCTGTACGTGGATGG - Intergenic
1159064426 18:63554121-63554143 GACTATAAGCTGAATAAGGGGGG + Intergenic
1167481365 19:49733808-49733830 GTCTATAAGCTTTAGGTCTGGGG - Intergenic
925256180 2:2490635-2490657 GACTAGAACCTGGAGGAGGGTGG + Intergenic
925982674 2:9189947-9189969 GACTATGAGCTGGAAGTTGGTGG - Intergenic
927699017 2:25256210-25256232 GCTTTTGAGCTGTAGGTGGGAGG - Intronic
927884812 2:26711888-26711910 CACTGTAAGCTGCAGCTGGGGGG + Intronic
928176084 2:29035302-29035324 GGCAACAAGCTGTAGGTGGAGGG + Intronic
928468733 2:31551816-31551838 GACTATGTGCTGTTGGTGGTGGG + Intronic
937116159 2:119406501-119406523 GAATATGAGCTGGAAGTGGGAGG + Intergenic
940015779 2:149102543-149102565 GACCAGAAGATGTAGGAGGGAGG + Intronic
941059335 2:160827712-160827734 GACTAGAAGGGGTAGGTGGAGGG + Intergenic
942594444 2:177579730-177579752 GACAATAAGCAGGAGGTAGGGGG - Intergenic
947066935 2:226237524-226237546 GACTCTAAGCAGTTGATGGGAGG + Intergenic
1169732079 20:8797233-8797255 TACTAAATGCTGTCGGTGGGGGG - Intronic
1171084809 20:22227895-22227917 AAGTATAGGCTGTAGGTGTGGGG + Intergenic
1171384588 20:24761662-24761684 GACTGTCAGCTGCAGGAGGGCGG + Intergenic
1173926918 20:46787620-46787642 GACTATAGGCTCTAGTTGGTTGG - Intergenic
1174586618 20:51613617-51613639 GGCTATACCATGTAGGTGGGTGG - Intronic
952512963 3:34075784-34075806 GAATATAAGCTGTATGAGAGTGG - Intergenic
957999719 3:87736213-87736235 GACTAGGAGCTGTATGTGGATGG - Intergenic
969082281 4:4628011-4628033 GACTGTCAGCTCTAGGAGGGTGG - Intergenic
972074138 4:35062459-35062481 GACTAAAAGATGTAGGGGAGAGG - Intergenic
972823847 4:42733653-42733675 TACTAGAAGGTGTGGGTGGGAGG - Intergenic
973613502 4:52658758-52658780 GGGGATAAGCTGGAGGTGGGGGG - Intronic
977043374 4:92041070-92041092 GACTGTGAGCTGTATGTGGGCGG - Intergenic
978639358 4:110851229-110851251 GACTCTAAGCTGCAGGGGGAGGG + Intergenic
979127208 4:116989417-116989439 GAACATAAGCTGCAGGAGGGCGG + Intergenic
980029940 4:127815730-127815752 GACTGTAAGTTATAGATGGGTGG - Intronic
981333822 4:143544610-143544632 GGCTATAAGCTCTATGAGGGTGG - Intronic
982939763 4:161535619-161535641 GCCTATATCCTGTTGGTGGGAGG + Intronic
986543848 5:8874100-8874122 GACAGTGAGCTGGAGGTGGGGGG - Intergenic
987979068 5:25056264-25056286 GACTATGAGCTGAACGGGGGGGG + Intergenic
991306275 5:65178980-65179002 GACTGTGAGCTGTACGTGGACGG + Intronic
993320451 5:86463128-86463150 GACTAGAAGCTGTATGTGGATGG + Intergenic
994051686 5:95369394-95369416 GACTATGAGGTGGAGGAGGGTGG - Intergenic
997965169 5:138351235-138351257 GCCCATAAGCTGTAGTTGGTAGG - Intergenic
1002902390 6:1420029-1420051 TACAATAAGCTGTTGTTGGGGGG + Intergenic
1003061785 6:2869461-2869483 GACCATTAGCAGGAGGTGGGTGG - Intergenic
1005281836 6:24282757-24282779 CATTATAAGCTGGGGGTGGGGGG + Intronic
1008123662 6:47645512-47645534 GACTGTGAGCTGTACGTGGACGG + Intergenic
1008268739 6:49463882-49463904 GACTATATGCTTTAGGAGAGAGG - Intronic
1012419027 6:99042039-99042061 AACTAGAAGCTGTATGTAGGTGG + Intergenic
1012582081 6:100881438-100881460 GACTAGAGGCTGGAGGCGGGAGG - Intergenic
1013391443 6:109690239-109690261 GAGTATAAGATGTAGGGGAGAGG - Intronic
1015120476 6:129695870-129695892 CCCTCTGAGCTGTAGGTGGGTGG - Intronic
1018731005 6:166650429-166650451 CACTTTAGGCTGGAGGTGGGAGG + Intronic
1020214605 7:6180092-6180114 GGCCATCAGCTGCAGGTGGGAGG + Intronic
1020372966 7:7454614-7454636 GACAGGAAGCTGTAGGTAGGAGG + Intronic
1020587156 7:10083123-10083145 GTCTGTAAGCTGTGGGTGGCAGG - Intergenic
1024818792 7:53303192-53303214 TACTATAAGAAGGAGGTGGGAGG + Intergenic
1026235235 7:68521368-68521390 GAGTATAAGCTGTGGATTGGTGG - Intergenic
1028761676 7:94504168-94504190 GAATATAAGATGTGGGTGGGGGG + Intergenic
1030167724 7:106571551-106571573 GACTATGAGCTTTAGGCAGGGGG + Intergenic
1033830971 7:145252003-145252025 GACTATAAGATGTAGGCTGGAGG + Intergenic
1034967450 7:155400098-155400120 GACTCTAGGCTGCTGGTGGGAGG - Intergenic
1037574978 8:20193559-20193581 GAGTATCAGCTGGAGGTGGGGGG - Intergenic
1040589633 8:48778488-48778510 GAATTTTATCTGTAGGTGGGTGG - Intergenic
1048728034 8:137408898-137408920 GAATAAAAGCTGAGGGTGGGAGG - Intergenic
1051807357 9:21010461-21010483 GACTGTAAGCTCTGGGGGGGGGG - Intronic
1052763088 9:32612599-32612621 GATTATAAGCAGGAAGTGGGGGG - Intergenic
1053062392 9:35042572-35042594 GACTATAAGCCCTAGATGTGAGG + Intronic
1055336601 9:75238426-75238448 GACTAAGTGCTGTAGCTGGGTGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1058903843 9:109465242-109465264 GACTATATCACGTAGGTGGGAGG + Intronic
1060548547 9:124474740-124474762 GACCAGGAGCTGTGGGTGGGGGG - Intronic
1186884099 X:13895420-13895442 GACCAAAAGCTGGGGGTGGGGGG + Intronic
1190600228 X:52084515-52084537 GAAAATAAGGTGTAGGTGTGTGG + Intergenic
1190756109 X:53403554-53403576 GCCAAGAAGCGGTAGGTGGGAGG - Exonic
1197532154 X:127642675-127642697 GACTATAAGAGGTGGGAGGGAGG - Intergenic
1201165019 Y:11201250-11201272 GTTTAGAAGCTGTTGGTGGGAGG - Intergenic