ID: 1146811977

View in Genome Browser
Species Human (GRCh38)
Location 17:35911164-35911186
Sequence GTGGAGACTGATCCTTTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146811977_1146811986 15 Left 1146811977 17:35911164-35911186 CCGGGAAAAGGATCAGTCTCCAC No data
Right 1146811986 17:35911202-35911224 CTCAGTTGGGGCCTTCTCTTGGG No data
1146811977_1146811987 21 Left 1146811977 17:35911164-35911186 CCGGGAAAAGGATCAGTCTCCAC No data
Right 1146811987 17:35911208-35911230 TGGGGCCTTCTCTTGGGTTGTGG No data
1146811977_1146811984 3 Left 1146811977 17:35911164-35911186 CCGGGAAAAGGATCAGTCTCCAC No data
Right 1146811984 17:35911190-35911212 AGAACATGGAGGCTCAGTTGGGG No data
1146811977_1146811983 2 Left 1146811977 17:35911164-35911186 CCGGGAAAAGGATCAGTCTCCAC No data
Right 1146811983 17:35911189-35911211 GAGAACATGGAGGCTCAGTTGGG No data
1146811977_1146811980 -8 Left 1146811977 17:35911164-35911186 CCGGGAAAAGGATCAGTCTCCAC No data
Right 1146811980 17:35911179-35911201 GTCTCCACAGGAGAACATGGAGG No data
1146811977_1146811982 1 Left 1146811977 17:35911164-35911186 CCGGGAAAAGGATCAGTCTCCAC No data
Right 1146811982 17:35911188-35911210 GGAGAACATGGAGGCTCAGTTGG No data
1146811977_1146811985 14 Left 1146811977 17:35911164-35911186 CCGGGAAAAGGATCAGTCTCCAC No data
Right 1146811985 17:35911201-35911223 GCTCAGTTGGGGCCTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146811977 Original CRISPR GTGGAGACTGATCCTTTTCC CGG (reversed) Intergenic