ID: 1146820316

View in Genome Browser
Species Human (GRCh38)
Location 17:35979406-35979428
Sequence GCTCTAACTTCTGTCTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 196}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146820316_1146820319 2 Left 1146820316 17:35979406-35979428 CCTTTAGAGACAGAAGTTAGAGC 0: 1
1: 0
2: 2
3: 17
4: 196
Right 1146820319 17:35979431-35979453 GAGGAAAAAGTATATGATTTAGG 0: 1
1: 1
2: 0
3: 49
4: 497
1146820316_1146820320 8 Left 1146820316 17:35979406-35979428 CCTTTAGAGACAGAAGTTAGAGC 0: 1
1: 0
2: 2
3: 17
4: 196
Right 1146820320 17:35979437-35979459 AAAGTATATGATTTAGGCTTTGG 0: 1
1: 0
2: 1
3: 30
4: 363
1146820316_1146820325 28 Left 1146820316 17:35979406-35979428 CCTTTAGAGACAGAAGTTAGAGC 0: 1
1: 0
2: 2
3: 17
4: 196
Right 1146820325 17:35979457-35979479 TGGGGTCAGACAGCTTGGGTTGG 0: 1
1: 0
2: 4
3: 32
4: 283
1146820316_1146820321 9 Left 1146820316 17:35979406-35979428 CCTTTAGAGACAGAAGTTAGAGC 0: 1
1: 0
2: 2
3: 17
4: 196
Right 1146820321 17:35979438-35979460 AAGTATATGATTTAGGCTTTGGG 0: 1
1: 0
2: 1
3: 17
4: 322
1146820316_1146820324 24 Left 1146820316 17:35979406-35979428 CCTTTAGAGACAGAAGTTAGAGC 0: 1
1: 0
2: 2
3: 17
4: 196
Right 1146820324 17:35979453-35979475 GCTTTGGGGTCAGACAGCTTGGG 0: 1
1: 3
2: 21
3: 153
4: 777
1146820316_1146820322 10 Left 1146820316 17:35979406-35979428 CCTTTAGAGACAGAAGTTAGAGC 0: 1
1: 0
2: 2
3: 17
4: 196
Right 1146820322 17:35979439-35979461 AGTATATGATTTAGGCTTTGGGG 0: 1
1: 1
2: 32
3: 383
4: 1056
1146820316_1146820323 23 Left 1146820316 17:35979406-35979428 CCTTTAGAGACAGAAGTTAGAGC 0: 1
1: 0
2: 2
3: 17
4: 196
Right 1146820323 17:35979452-35979474 GGCTTTGGGGTCAGACAGCTTGG 0: 1
1: 3
2: 19
3: 135
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146820316 Original CRISPR GCTCTAACTTCTGTCTCTAA AGG (reversed) Intronic