ID: 1146822393

View in Genome Browser
Species Human (GRCh38)
Location 17:35994104-35994126
Sequence CTGTGCTTGTAGCTTTATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146822393_1146822400 24 Left 1146822393 17:35994104-35994126 CCAGGATAAAGCTACAAGCACAG 0: 1
1: 0
2: 2
3: 4
4: 125
Right 1146822400 17:35994151-35994173 GCTGTGGGAACCTCTTGGAGGGG 0: 1
1: 1
2: 1
3: 18
4: 198
1146822393_1146822397 19 Left 1146822393 17:35994104-35994126 CCAGGATAAAGCTACAAGCACAG 0: 1
1: 0
2: 2
3: 4
4: 125
Right 1146822397 17:35994146-35994168 TATTTGCTGTGGGAACCTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 171
1146822393_1146822399 23 Left 1146822393 17:35994104-35994126 CCAGGATAAAGCTACAAGCACAG 0: 1
1: 0
2: 2
3: 4
4: 125
Right 1146822399 17:35994150-35994172 TGCTGTGGGAACCTCTTGGAGGG 0: 1
1: 0
2: 0
3: 23
4: 185
1146822393_1146822398 22 Left 1146822393 17:35994104-35994126 CCAGGATAAAGCTACAAGCACAG 0: 1
1: 0
2: 2
3: 4
4: 125
Right 1146822398 17:35994149-35994171 TTGCTGTGGGAACCTCTTGGAGG 0: 1
1: 0
2: 0
3: 19
4: 176
1146822393_1146822395 8 Left 1146822393 17:35994104-35994126 CCAGGATAAAGCTACAAGCACAG 0: 1
1: 0
2: 2
3: 4
4: 125
Right 1146822395 17:35994135-35994157 ATAAAAAAGGATATTTGCTGTGG 0: 1
1: 0
2: 4
3: 48
4: 524
1146822393_1146822394 -5 Left 1146822393 17:35994104-35994126 CCAGGATAAAGCTACAAGCACAG 0: 1
1: 0
2: 2
3: 4
4: 125
Right 1146822394 17:35994122-35994144 CACAGTTTTCAAAATAAAAAAGG 0: 1
1: 0
2: 9
3: 114
4: 1041
1146822393_1146822396 9 Left 1146822393 17:35994104-35994126 CCAGGATAAAGCTACAAGCACAG 0: 1
1: 0
2: 2
3: 4
4: 125
Right 1146822396 17:35994136-35994158 TAAAAAAGGATATTTGCTGTGGG 0: 1
1: 0
2: 1
3: 49
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146822393 Original CRISPR CTGTGCTTGTAGCTTTATCC TGG (reversed) Intronic
906182408 1:43833640-43833662 CTCTGCTTGGATTTTTATCCTGG - Intronic
907126736 1:52056699-52056721 GTGTGCTTTGAGCTTTATACAGG + Intronic
908415614 1:63910627-63910649 CTGTGTTGGGACCTTTATCCTGG + Intronic
915770855 1:158421452-158421474 TTGTTTCTGTAGCTTTATCCTGG + Intergenic
916453798 1:164949328-164949350 CTGTTCTTCTAACTTTCTCCAGG + Intergenic
923128963 1:231058153-231058175 CTGAGTTTGTAGCTATATCTTGG - Intergenic
1064296158 10:14080611-14080633 CTGTGATTGTAGCTGTGTCCAGG - Intronic
1064402915 10:15036146-15036168 CTGTGGTTATAGCTATTTCCTGG + Intronic
1068730820 10:60356314-60356336 CTGTGCATGTATCTATATACTGG + Intronic
1074826785 10:117220494-117220516 CTGTGCTTGTCACATTCTCCTGG + Intergenic
1075191357 10:120312287-120312309 TTGGGCTTGTTCCTTTATCCTGG - Intergenic
1076648099 10:131967957-131967979 CTGAGTTTGTAGCTCTATCTTGG + Exonic
1081748983 11:45494319-45494341 CTGTTCTTGGAGCTTAATCTTGG - Intergenic
1081849144 11:46262915-46262937 CTGTGCATGTAGCTTCTGCCAGG + Intergenic
1082130788 11:48486688-48486710 ATGTACTGGAAGCTTTATCCAGG - Intergenic
1083851659 11:65371242-65371264 CTGCGCATGTAGCTTTCCCCAGG + Intergenic
1084164568 11:67369419-67369441 CTGAGCTTGTGGCTTCCTCCTGG + Intronic
1086527772 11:87749114-87749136 CTGTTCTTTTTGCTTTCTCCTGG + Intergenic
1091347929 11:134867745-134867767 CTGTGCGTGTAGCTCTATGCAGG + Intergenic
1091628125 12:2138347-2138369 CTGTGCTTGCAGATGGATCCTGG + Intronic
1092075104 12:5666222-5666244 TTGTCCTGGTAGCTTTTTCCAGG - Intronic
1096562828 12:52449222-52449244 CTGTGCTTTTAGCTTCACCTTGG - Intronic
1096791902 12:54050609-54050631 CTGTGCTTGTAATAATATCCAGG + Intronic
1097458584 12:59832397-59832419 CTGTCCTTTAAACTTTATCCTGG + Intergenic
1098796567 12:74895816-74895838 ATGTGCTTTTAGCTTTTCCCTGG - Intergenic
1100860704 12:98803391-98803413 GTGTTGTTGTTGCTTTATCCAGG - Intronic
1101413705 12:104490545-104490567 TTGTGCTTGTACCTTGATCTGGG - Intronic
1109713030 13:66183645-66183667 CTGTGATTCTAGCTTCATCAGGG + Intergenic
1110411773 13:75212170-75212192 ATGTGCTTGTATCTTTATAATGG - Intergenic
1112323746 13:98429703-98429725 CTGTGTTTCCAGCTTTTTCCGGG + Intronic
1112952673 13:105020444-105020466 CTGTGCTTGTATCTTTATGCTGG + Intergenic
1113085957 13:106569842-106569864 CTCTGCTGGTACCTTTATCTTGG - Intergenic
1114989183 14:28265681-28265703 CTGAGTTTGTAGCTCTATCTTGG - Intergenic
1114990203 14:28277165-28277187 CTGTGCTAATAGCTTTTACCCGG + Intergenic
1115000068 14:28411269-28411291 CACTGCTTGTAGATTCATCCTGG - Intergenic
1117738904 14:58795137-58795159 CTGTGCTAAAAGCTTTAACCAGG + Intergenic
1120182848 14:81363472-81363494 CTTTGTTTGAAGCTTTTTCCAGG - Intronic
1124060908 15:26292966-26292988 GTCTGCTTGTTGCTTTATCTTGG + Intergenic
1128492080 15:68157698-68157720 CTGTTCTTGGAGTTTTATCTTGG + Intronic
1129260614 15:74365268-74365290 CAGGGCTTGTGGCTTTTTCCTGG - Intronic
1130404388 15:83584922-83584944 CTGAGTTTGTTGCTTTATCTTGG + Intronic
1130676963 15:85961341-85961363 ATGTGATTGTATCTTGATCCTGG - Intergenic
1133446653 16:5866874-5866896 CTGTCATTGTAGCTTTTACCTGG + Intergenic
1133691009 16:8215150-8215172 CTGTTCATGTACCTTTATTCAGG + Intergenic
1140746945 16:77988875-77988897 TTATGCTTCTAGCTTTTTCCTGG - Intergenic
1142707928 17:1708344-1708366 TTATGCTTTTACCTTTATCCTGG + Intronic
1146822393 17:35994104-35994126 CTGTGCTTGTAGCTTTATCCTGG - Intronic
1156257325 18:35410474-35410496 CTTTGCTTCTACCTTTCTCCAGG + Intergenic
1157200936 18:45659021-45659043 CGGTGCATGTAGCTTCACCCTGG - Intronic
1165849677 19:38842505-38842527 CTGTGCTTGTAGCTGTTCCTTGG + Intronic
925362809 2:3291166-3291188 GTGTGCCTGTAGCTTCATTCTGG - Intronic
931138132 2:59427393-59427415 CTTTGCTTGTAGCATTTTTCAGG - Intergenic
931967715 2:67551789-67551811 CTGAGTTTGTAGCTTGAGCCTGG + Intergenic
933876433 2:86624885-86624907 CTGTGCTTATAAATTTAACCGGG + Intronic
933978768 2:87533569-87533591 CTTTGCTTTTAGCTTTGCCCTGG - Intergenic
936315062 2:111417225-111417247 CTTTGCTTTTAGCTTTGCCCTGG + Intergenic
940853888 2:158714837-158714859 CTGTGCTTGTTGCTGTTTCCAGG + Intergenic
941142042 2:161795942-161795964 CTCAGCTTGTACCTTTATGCAGG + Intronic
944025004 2:195154043-195154065 CTGTGCTAATAGCTATATTCAGG + Intergenic
945156947 2:206849233-206849255 CTGTGCCTTTATCTTTCTCCAGG + Intergenic
1168784686 20:528039-528061 CTGTTTTTGTAGCTCTATCAAGG - Exonic
1172165081 20:32893977-32893999 CTGTGCTTTTAGCCTTTTGCTGG + Intronic
1174711718 20:52713619-52713641 ATGTCCTTGTAATTTTATCCTGG + Intergenic
1177103909 21:16931359-16931381 CTGAGCTTGTAGCTATTTACTGG - Intergenic
1178626810 21:34225258-34225280 CTGTGCCTGTTGCTTTCTCGAGG - Intergenic
1178753005 21:35322154-35322176 ATGTACTTGTGCCTTTATCCTGG - Intronic
1181656099 22:24300443-24300465 GTGTGCTTGTATCTTTATAGTGG + Intronic
950035786 3:9884552-9884574 TTTTGCTTGTACCTTTCTCCTGG - Intergenic
950381861 3:12622768-12622790 CTGTTTTTGTAGCATTATTCTGG - Intronic
955520740 3:59773210-59773232 CAGGGCTTGAAGCTTTATCATGG - Intronic
955666942 3:61359623-61359645 CTTATCATGTAGCTTTATCCTGG + Intergenic
958943539 3:100339145-100339167 TCGCGCTTGTAGCTTCATCCGGG + Exonic
962911658 3:139856613-139856635 CTCTGCTTGTCACTTTAACCTGG - Intergenic
964535451 3:157716393-157716415 CTGTGCCTGTTGCTTTATGGTGG - Intergenic
965538562 3:169850028-169850050 CTCTGTTTTTAGCATTATCCAGG - Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
971437825 4:26646490-26646512 CTGTGCATGTATCTTTATAGTGG - Intronic
975586813 4:75958330-75958352 CTGCACTTGTACATTTATCCTGG + Intronic
976122210 4:81795573-81795595 CTGTGCTTGTAGGCTCACCCTGG - Intronic
976147530 4:82056836-82056858 CTCTGCTTGTTGCATTATCATGG - Intergenic
982201330 4:152963946-152963968 CTGTAGTCGTAGCTTTAACCTGG + Intronic
982365173 4:154570183-154570205 CTGTGTTTGTTACTTTATACTGG - Intronic
982403365 4:154993455-154993477 CTGTGCTGGTACCTTGATCTTGG - Intergenic
991146306 5:63309175-63309197 CTGTGTTTGTAGCTGTTACCTGG + Intergenic
991628332 5:68628157-68628179 CTGTGCTTTTTCCTTCATCCAGG - Intergenic
993598410 5:89888654-89888676 CTCTGCTTGCAGCTTGATCTTGG + Intergenic
994324259 5:98430910-98430932 CTGTGCCTTTAGCTATATGCTGG - Intergenic
995076416 5:107990106-107990128 CTGTGGTTGTTGCTTTCTTCTGG + Intronic
996402866 5:123082480-123082502 CTGTACTGATGGCTTTATCCTGG + Intergenic
996689090 5:126318631-126318653 CTGTCCTTGTAGTTTTTTCTGGG - Intergenic
997955465 5:138275356-138275378 TTCTGCTTCTGGCTTTATCCTGG - Intergenic
998788344 5:145737576-145737598 CTGTGCTTGTTGCTGTTTTCAGG - Intronic
1002669325 5:180853170-180853192 CTGTGCTTGGAGATTTATGTAGG - Intronic
1004273679 6:14216647-14216669 CTGTGCTTGTTTCTTTAGCAGGG + Intergenic
1008589745 6:52982176-52982198 CTGTGCATGGAGTTTTTTCCAGG + Intronic
1009272669 6:61634316-61634338 CTGTCCTTGTGGCTTTAGACTGG - Intergenic
1011113776 6:83867277-83867299 CTGTGTTTGTACCTTTGTTCAGG - Intronic
1016889359 6:148990492-148990514 CTGGGATTGTAATTTTATCCAGG - Intronic
1019808146 7:3144081-3144103 CTGTGTTTGCAGCTTCATCTGGG + Intronic
1021237997 7:18166813-18166835 ATTTGTTTGTAGCTTTGTCCTGG - Intronic
1023119851 7:36898546-36898568 CTGTGCTTGTACCTTTAACCCGG - Intronic
1023602808 7:41896887-41896909 CTGGGCTTTTAGCTGTCTCCTGG + Intergenic
1024557340 7:50614896-50614918 CTGTGCTTGAGACTTTAACCTGG - Intronic
1026116275 7:67498300-67498322 CTGTCCTTGTAGCATTTTCTGGG - Intergenic
1028871769 7:95778231-95778253 CTGTGGTTGTAGAATTATTCGGG - Intronic
1029160589 7:98548907-98548929 CTGTGCTTATGGTTTTATTCTGG + Intergenic
1030515893 7:110537294-110537316 CTGTGTTAGTAGGTTTATCTTGG + Intergenic
1031347469 7:120686697-120686719 CTGTGCTTGTAGCCCTTCCCAGG - Intronic
1031829355 7:126607908-126607930 CTGTTCTTGTAGTTATTTCCTGG + Intronic
1033580664 7:142730878-142730900 CTGTTTTTGTAGCTTTTTGCTGG + Intergenic
1040496357 8:47969064-47969086 CTGTGCTTCTAGCTCAATGCTGG - Intronic
1044621315 8:94193069-94193091 CTGTGCTTGTGGCTTTCACCTGG + Intronic
1046098976 8:109593032-109593054 CTGTGCATGAAGATTTATCTGGG + Intronic
1046638280 8:116697182-116697204 GTGTGCTTGTCCCTTTTTCCAGG + Intronic
1047834376 8:128672312-128672334 CTCTGCTTTTAGCTGTATTCTGG + Intergenic
1051782922 9:20710271-20710293 TTTTGCCTGTGGCTTTATCCAGG + Intronic
1053751266 9:41258577-41258599 ATGTGCTTGTATCTTTATAGTGG + Intergenic
1056509978 9:87295409-87295431 CTGTGCTTTTTGTTTTGTCCAGG + Intergenic
1056604508 9:88075894-88075916 CTGTGCCTTTAGTTTTACCCTGG - Intergenic
1057853417 9:98583059-98583081 CTGGGCTTGCGGCATTATCCTGG - Intronic
1057982945 9:99680792-99680814 TTTTTCTTTTAGCTTTATCCAGG + Intergenic
1062253576 9:135610522-135610544 CTGTGCCTGTGGTTTGATCCTGG + Intergenic
1062521144 9:136958515-136958537 CTCTGCTTGTGCCTTTGTCCGGG - Intergenic
1185787572 X:2903768-2903790 CTGTGCTTTTAGGGTTATACAGG - Intergenic
1186061985 X:5718969-5718991 CTGTGATTTTAGCTTTAGGCTGG + Intergenic
1186143103 X:6597878-6597900 CTGTGCTTCTAGCTCCATCAGGG + Intergenic
1187296400 X:18005417-18005439 CTGTGCATAGACCTTTATCCAGG + Intergenic
1191265017 X:58379797-58379819 TTGTTCTTCTAGTTTTATCCTGG + Intergenic
1196640632 X:118055894-118055916 TTGTGCTAGAAGCTCTATCCAGG + Intronic
1197128299 X:122973363-122973385 CTATGCTTTGAGCTTTATCGTGG + Intergenic
1201050382 Y:9926910-9926932 CTGTTATTATAGCTATATCCTGG - Intergenic
1201525256 Y:14925950-14925972 CTGTGGTTGTTGTTTTATTCAGG + Intergenic