ID: 1146823376

View in Genome Browser
Species Human (GRCh38)
Location 17:36002299-36002321
Sequence GCTCAAGTATGTGCACTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146823376_1146823380 8 Left 1146823376 17:36002299-36002321 CCTCTTAGTGCACATACTTGAGC No data
Right 1146823380 17:36002330-36002352 CTGACTCCTGAGATCTTAATGGG No data
1146823376_1146823379 7 Left 1146823376 17:36002299-36002321 CCTCTTAGTGCACATACTTGAGC No data
Right 1146823379 17:36002329-36002351 CCTGACTCCTGAGATCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146823376 Original CRISPR GCTCAAGTATGTGCACTAAG AGG (reversed) Intergenic
No off target data available for this crispr