ID: 1146824948

View in Genome Browser
Species Human (GRCh38)
Location 17:36013896-36013918
Sequence TCTCCTCCAGAGCACTGTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146824944_1146824948 15 Left 1146824944 17:36013858-36013880 CCTGCAGCATGAGAAAGGGTCAT 0: 1
1: 0
2: 3
3: 19
4: 132
Right 1146824948 17:36013896-36013918 TCTCCTCCAGAGCACTGTGGAGG 0: 1
1: 0
2: 1
3: 30
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146824948 Original CRISPR TCTCCTCCAGAGCACTGTGG AGG Exonic
901205484 1:7492521-7492543 GCTCCTGCATAGCACTGTGAGGG + Intronic
901849391 1:12005946-12005968 TCACCTCAAGGGCATTGTGGGGG + Intronic
904322220 1:29705374-29705396 TCCCCTCCTGGACACTGTGGGGG - Intergenic
904478726 1:30781217-30781239 TCTACTCCACTCCACTGTGGAGG - Intergenic
904789475 1:33007935-33007957 TCTCCTCGATAACCCTGTGGAGG - Intergenic
906259757 1:44378067-44378089 TTTCCACCAGAGCACCGTAGTGG + Intergenic
907471848 1:54679418-54679440 CCACCTCCAGCGCCCTGTGGCGG - Exonic
910213083 1:84813915-84813937 ACTCCTGCTGAGGACTGTGGAGG + Exonic
912304284 1:108549530-108549552 TGTCCTTCAGAGTACTTTGGAGG - Intergenic
912980604 1:114368266-114368288 TGTCCTCTTAAGCACTGTGGGGG + Intergenic
916572752 1:166041581-166041603 GGACCTCCAGAGGACTGTGGTGG + Intergenic
917734221 1:177905873-177905895 CCTCCAACAGAGCTCTGTGGGGG + Intergenic
918107078 1:181424694-181424716 TCTTTTCCAGAGCACAGTGCTGG + Intronic
918647724 1:186921835-186921857 TGTCCTCTTGACCACTGTGGGGG + Intronic
919273134 1:195376862-195376884 TTTCCAACAGAGCACAGTGGTGG + Intergenic
919785228 1:201254438-201254460 CCTCCCCCAGAGCACTGTGCGGG + Intergenic
920077439 1:203347676-203347698 GCCCCTCCAGAGCATTGTTGGGG + Exonic
920379702 1:205528391-205528413 CCTCCCCCAGAGGCCTGTGGGGG + Intronic
922903185 1:229154351-229154373 TCTCCCCCAGAGCCCTCTGTGGG + Intergenic
923068840 1:230544543-230544565 TCTTCTCCAGCTCACAGTGGTGG + Intergenic
924013449 1:239693096-239693118 TCTCCTTCAAAGCAGTGTGAAGG - Intronic
1064099156 10:12448495-12448517 TCTCCTCCAGAGAACTCTGTGGG - Intronic
1069486517 10:68827412-68827434 TCTCCTCCAGAGCGCTCCGCCGG + Intergenic
1070643825 10:78187640-78187662 TCTCCTGCAGGGGACTGAGGGGG + Intergenic
1071275171 10:84047779-84047801 TCTTATCCAGACCATTGTGGTGG + Intergenic
1071359378 10:84830557-84830579 TCTCCTGAAGAGCTCTGGGGTGG + Intergenic
1073064805 10:100751668-100751690 TCTCCCCGAGAGCACACTGGAGG - Intronic
1075222765 10:120599147-120599169 TCTCCTCCACATCTCTGAGGCGG - Exonic
1075844471 10:125534335-125534357 TCTCCTGCAGGGCACTGGGCAGG + Intergenic
1078845148 11:15113731-15113753 TCTCCTCCTCAGCTCTCTGGGGG - Intronic
1083885484 11:65571492-65571514 CCTCGTCCGGAGCACTGTGAGGG + Exonic
1084270516 11:68026951-68026973 TCTCCTCCAGGGCAGGGAGGCGG - Intronic
1086235701 11:84627498-84627520 TCTCCCCCAGAGTACTGCAGCGG + Intronic
1087153884 11:94882616-94882638 TCCCCTCCAGAACACTGTGATGG - Intergenic
1088789311 11:113210592-113210614 TCTCTTCCAGACCTCTCTGGTGG + Intronic
1088849437 11:113693158-113693180 TCTCCACCAGAGCCCCTTGGTGG + Exonic
1089655503 11:119944121-119944143 TCTCCTCCAGGGCTCTCTGAAGG - Intergenic
1090045235 11:123326108-123326130 TCTACTCCAGACCCCTCTGGTGG + Intergenic
1090248421 11:125234295-125234317 TCTCTTCCCCAGCAATGTGGAGG + Intronic
1090621977 11:128568332-128568354 TCCCCTTCACAGCACTGTGCTGG - Intronic
1091756301 12:3054545-3054567 TCTTTTCACGAGCACTGTGGAGG - Intergenic
1091893905 12:4084811-4084833 GCTCCTCCAGAGCTCTGCGCTGG - Intergenic
1092140398 12:6179626-6179648 GCTCCTTCTGAGCACTGTGAGGG + Intergenic
1092510727 12:9153331-9153353 TCTCTTCCAGGACACAGTGGTGG - Exonic
1093250411 12:16796328-16796350 TCTAGCCCAGAGCACAGTGGGGG + Intergenic
1095373346 12:41496337-41496359 TCACCACCATAGCACTGTGCCGG + Intronic
1095951352 12:47783594-47783616 TGTTCTCGAGAGCCCTGTGGGGG + Exonic
1096629488 12:52916736-52916758 TCTGCTGCTGAGGACTGTGGTGG - Intronic
1096916324 12:55037317-55037339 TTTCCACCAGAGCAGTGTGATGG - Intergenic
1099222870 12:79935082-79935104 TATCCCACAGAGCACTGGGGCGG + Exonic
1100101081 12:91106761-91106783 AGTCCTCCAGAGCACTGTGATGG + Intronic
1100438298 12:94592058-94592080 TCCCCTCCAGCACACAGTGGGGG - Intronic
1101085690 12:101233599-101233621 TCTGCTCAAAGGCACTGTGGGGG + Intergenic
1101209529 12:102522248-102522270 TGTACTCCAGATGACTGTGGGGG + Intergenic
1101733699 12:107447051-107447073 TCGGTTCCAGAACACTGTGGGGG + Intronic
1103517852 12:121518956-121518978 GCTCCTCCAGACCAGGGTGGGGG + Intronic
1105580691 13:21693172-21693194 TCCCCTCCTCAACACTGTGGTGG - Intronic
1108198356 13:48017877-48017899 TCTGCTCCAGAGCTCCGTGTTGG - Intergenic
1110187627 13:72693376-72693398 CCTCCACTAGGGCACTGTGGAGG + Intergenic
1113518433 13:110920707-110920729 TCCCCTCCAGAGCAGAGCGGGGG - Intergenic
1113911626 13:113844051-113844073 TCTCCTCCAGAGCACGTGGCTGG - Intronic
1114529479 14:23386770-23386792 TCTCCCCAATAGCACCGTGGTGG - Intronic
1117656159 14:57958918-57958940 TCTCCTCCAGAGCATTTGGAAGG - Intronic
1119014259 14:71032918-71032940 TGTCCTCCACAGCACTGAGCAGG - Intronic
1119484226 14:74977752-74977774 TCTCCTCGAGACCACCCTGGTGG - Intergenic
1122029019 14:98899258-98899280 TCTGCTCCAGAAGACTGGGGAGG + Intergenic
1122307853 14:100776893-100776915 CCTCCTCCAGCCCACGGTGGGGG - Intergenic
1122536354 14:102466225-102466247 TCGGCTCCAGAGCTCTGTGGAGG + Intronic
1122799908 14:104224374-104224396 TCTGCTCCAGGGCCCTGGGGAGG + Intergenic
1124444988 15:29722574-29722596 GCACCTCCAGGGCAGTGTGGAGG + Intronic
1125769973 15:42158789-42158811 CCTTCTCCATAGCTCTGTGGAGG + Exonic
1126261058 15:46691822-46691844 TCTCCTCTAAAGCACTGTTTAGG + Intergenic
1128751324 15:70152191-70152213 GTTCCTCCAGAGCACTGTGCTGG - Intergenic
1129119961 15:73390183-73390205 TCTCTTCCAGAGAAGTGTGGAGG + Intergenic
1129743977 15:78005241-78005263 TGTCCTCCAGAGCTCAGTGGAGG - Intronic
1130140373 15:81221280-81221302 TCTCCTCCAGAGGATTCCGGGGG - Intronic
1131259970 15:90883099-90883121 TCTCCACCAGGGCACAGTGTTGG - Exonic
1133403648 16:5506542-5506564 GCACCTCCAGAGCAGTGTGTGGG - Intergenic
1133658169 16:7887423-7887445 TCTCCTCCGGAGCTCTGAGCAGG + Intergenic
1135427277 16:22349382-22349404 TCACCTCCAGAGCCAAGTGGAGG - Exonic
1135983946 16:27169775-27169797 TCTCCACTAGAGCAGTCTGGTGG + Intergenic
1139850706 16:69950441-69950463 TCTGCTCCAGCTCACTCTGGTGG + Intergenic
1139879691 16:70173353-70173375 TCTGCTCCAGCTCACTCTGGTGG + Intronic
1140372834 16:74422195-74422217 TCTGCTCCAGCTCACTCTGGTGG - Intergenic
1141756114 16:85992110-85992132 TGCCATCCAGGGCACTGTGGGGG + Intergenic
1142318761 16:89367320-89367342 CCTCCTCCTGAGCACAGTGGCGG + Intronic
1144494437 17:15737499-15737521 TCACCTCCAGGGCACTGACGTGG - Exonic
1144905828 17:18639177-18639199 TCACCTCCAGGGCACTGACGCGG + Exonic
1145214866 17:21043404-21043426 TCTCTTCCAGAGGACTGGGGAGG + Intronic
1146132576 17:30291766-30291788 GCTCCTCCAGAGGACCGCGGCGG + Intronic
1146810046 17:35895997-35896019 TCTAATTCAGAGAACTGTGGAGG + Intergenic
1146822825 17:35998429-35998451 TCTCCTCGAAAGCACAGTGGAGG + Intronic
1146824948 17:36013896-36013918 TCTCCTCCAGAGCACTGTGGAGG + Exonic
1147595715 17:41715845-41715867 TCTCATCCTCAGCACTGCGGCGG - Exonic
1147969496 17:44212003-44212025 TCTCCTGCAGAGCCAGGTGGGGG + Exonic
1148129674 17:45255326-45255348 GCCCCTCCTGACCACTGTGGAGG - Exonic
1148646762 17:49223840-49223862 CCTCCTCCAGTCTACTGTGGAGG - Exonic
1149603662 17:57909807-57909829 GCTTCTCCAGAGCAATGGGGAGG + Intronic
1151474872 17:74339675-74339697 TCTCATGAAGAGCACGGTGGTGG + Intronic
1152119028 17:78406820-78406842 TCTCCTCAACTGCACTGTGCTGG + Intronic
1152538813 17:80964695-80964717 TCTCCGCCAGGGCTCTGTCGGGG - Exonic
1153642665 18:7169902-7169924 TCTCCTCTGGAGCCTTGTGGGGG + Intergenic
1153947486 18:10030527-10030549 TCTCATACATAGCACTGTGGTGG - Intergenic
1154353147 18:13603866-13603888 TCTCCTGCAGTGCATCGTGGTGG + Intronic
1156451096 18:37266867-37266889 GCTCATGCAGAGCACTGTGGAGG + Intronic
1156502635 18:37569158-37569180 TCTCCTCCATAGCAGAGTGTTGG + Intergenic
1157298784 18:46464788-46464810 TGGCCTGCAGAGCACTGGGGAGG - Intergenic
1160172633 18:76567629-76567651 TCTCCTCCCTAGACCTGTGGGGG - Intergenic
1160533241 18:79577460-79577482 TCTCTCCCACCGCACTGTGGTGG - Intergenic
1161777344 19:6270747-6270769 TCTCCTCCAGTGCACCGTCCAGG - Exonic
1162016589 19:7849662-7849684 TCTCCTCCAGAGAAATCGGGAGG + Intronic
1162463063 19:10824689-10824711 TCTACTCCAGGGCGCTGAGGTGG + Intronic
1163864120 19:19757989-19758011 TCTCTACCAGGGCAGTGTGGAGG - Intergenic
1164748865 19:30636314-30636336 TCTCCCCCATGGCAATGTGGGGG + Intronic
1166182680 19:41120051-41120073 TCTCCTTCACAGAACTGTGAAGG - Intronic
1166936289 19:46335131-46335153 TCTTCTCATGGGCACTGTGGAGG + Intronic
1167289104 19:48614883-48614905 CCTCCTCCAGGGGCCTGTGGGGG - Intergenic
1167451568 19:49573307-49573329 TCTCCTCCAGAGCACTGCCAAGG + Intronic
1168355562 19:55697718-55697740 GCTCCTGCTGAGCACTTTGGTGG - Intronic
925449098 2:3953102-3953124 TCTACTGCAGAGCCATGTGGAGG + Intergenic
927937418 2:27083557-27083579 TGAGCTCCAGACCACTGTGGAGG + Exonic
929567924 2:43001066-43001088 TCTCCTCCCGGGCATTGTAGGGG - Intergenic
930421335 2:51156870-51156892 ACTCCTTTAGAGCACAGTGGAGG - Intergenic
930744757 2:54870800-54870822 ACTCCTACAGAGGTCTGTGGAGG - Intronic
931159961 2:59678279-59678301 TTTTCTCCATTGCACTGTGGTGG + Intergenic
932459816 2:71874956-71874978 GCACCTGGAGAGCACTGTGGAGG - Intergenic
934556312 2:95288823-95288845 TCTCCTCGGAAGCCCTGTGGGGG - Intronic
936013023 2:108937010-108937032 TCCCCGGCACAGCACTGTGGGGG - Intronic
937736679 2:125299153-125299175 TCTCCTCCACAGCACAGTGGTGG + Intergenic
937767800 2:125681417-125681439 TCTCCGCCAGAGCTCTTGGGTGG - Intergenic
938306833 2:130262399-130262421 GCTTCTCAAGAGCCCTGTGGGGG - Intergenic
947823704 2:233090044-233090066 TCTCCCCCAGTGAGCTGTGGAGG + Intronic
948578735 2:238970271-238970293 TTTCCCCAAGAGCACTGTGCTGG + Intergenic
1168871920 20:1136326-1136348 TCACAGCCAGAGCACTGTGCAGG - Intronic
1168997323 20:2143174-2143196 TCTGCTGCAGTGCACTGTGGGGG - Intronic
1168997438 20:2143816-2143838 TCTCCTCCAGAGGACGGCAGAGG + Exonic
1172772441 20:37389453-37389475 TCTCCTCCAGAGACCTGTGCTGG + Intronic
1173069945 20:39754190-39754212 TCCCCTCCAGAACACTGGAGTGG - Intergenic
1173993210 20:47318726-47318748 TCTCCTCCAGAGGACTGCACTGG + Intronic
1174798120 20:53539590-53539612 ACTCCTCCAGAGAGTTGTGGAGG + Intergenic
1175629621 20:60524289-60524311 TCTCATAGAGAGCTCTGTGGAGG - Intergenic
1175748821 20:61480661-61480683 TCTCCCCAAGAGCACTGTGTGGG + Intronic
1176094912 20:63336171-63336193 TCTCTGCCCCAGCACTGTGGTGG - Intergenic
1176890491 21:14312102-14312124 TCTCTTCCATGGCACTCTGGAGG + Intergenic
1177312306 21:19413309-19413331 TCTCTACCAGGGCAGTGTGGAGG + Intergenic
1179438877 21:41379704-41379726 TCACTTCCAGGGCAGTGTGGTGG + Intronic
1179488973 21:41728121-41728143 TTTCCTGGAGGGCACTGTGGAGG - Intergenic
1179708536 21:43196173-43196195 TCTCCTCCAGTTCACTGGAGTGG - Intergenic
1181051334 22:20239547-20239569 TCCCCTCCAGGCCACAGTGGGGG - Intergenic
1181133734 22:20749982-20750004 CCTCTTCCAGAGCATTGTGAAGG - Exonic
1181457704 22:23069179-23069201 TCTCCATCATAGCTCTGTGGTGG - Intronic
1182819026 22:33198123-33198145 TAACCTCCAGAGCGGTGTGGTGG + Intronic
1182850848 22:33472972-33472994 TGTCTTCTAGAGCACTGGGGTGG + Intronic
1182891766 22:33825157-33825179 TCTACTACAAAGCACTATGGAGG + Intronic
1183433068 22:37777508-37777530 TCTACCCCAGAGGACTGTGTAGG + Intergenic
1183691904 22:39394944-39394966 TCTCCTCCAGAGATCTGGGGTGG - Intergenic
1184612477 22:45613550-45613572 TCTCCTTCTGAGAACTGTGCTGG + Intergenic
950565807 3:13768879-13768901 TCTCCTCCGGAACTCTGTGAGGG - Intergenic
951586399 3:24219570-24219592 TCTACTCCTGAGGACTGTGTAGG - Intronic
951982714 3:28583254-28583276 TCTCCTCCACTGAACTGTGGCGG - Intergenic
953814050 3:46139469-46139491 GCTCCACAAGAGCCCTGTGGTGG - Intergenic
954873339 3:53784524-53784546 TCTCCTGCAGAGCTCTGGGTGGG + Intronic
961509941 3:127394603-127394625 TTTTTTCCTGAGCACTGTGGAGG + Intergenic
961834606 3:129646602-129646624 TCTCCTGCATAAGACTGTGGGGG + Intergenic
962058234 3:131897161-131897183 TCTCATCCAGTTCTCTGTGGAGG - Intronic
962238932 3:133733762-133733784 TCTCCTCTACAGGACTGTGAAGG - Intergenic
964016980 3:151959971-151959993 GCTACCCCAGAGGACTGTGGAGG + Intergenic
964528586 3:157643085-157643107 TCTCCTACAGAAAGCTGTGGAGG + Intronic
966087512 3:176086615-176086637 TCTCCTTCAGAGCTCTTGGGTGG + Intergenic
967133300 3:186492538-186492560 TCTGCTCCAGAGAACAGTGGAGG - Intergenic
967488678 3:190063667-190063689 TCTCCTCACGCCCACTGTGGTGG + Intronic
967977053 3:195041305-195041327 TCTCCTCCAGAGAATGGGGGCGG - Intergenic
969195751 4:5562588-5562610 TCTCCTCCAGGGCCCTGGGGAGG + Exonic
969219844 4:5752449-5752471 TTTCCTCCACAGCCCTGTGGGGG + Intronic
969617083 4:8260009-8260031 TGGCCTCCAGAGAACTGTGGGGG - Intergenic
969921426 4:10544045-10544067 TCACCTCCAGAGCTCCCTGGTGG + Intronic
970581827 4:17480640-17480662 GCTCCTCCAGAGTACTGGGGAGG - Intronic
970600754 4:17639383-17639405 TCTCCTCCAGGAACCTGTGGTGG + Exonic
972406077 4:38747831-38747853 TCTCCACTAGGGCAATGTGGAGG + Intergenic
974085457 4:57255801-57255823 TCAGCTCCAGAGCACTATGCGGG + Intergenic
977290918 4:95163397-95163419 TCTGATCCTGAGCACTATGGAGG - Exonic
978077239 4:104547222-104547244 TTTCCTCCAGAGCAAAGGGGAGG - Intergenic
979775208 4:124581683-124581705 TCTCTACTAGAGCAGTGTGGAGG - Intergenic
981270382 4:142839930-142839952 TGTCCTCAAGATCAATGTGGTGG - Intronic
981349131 4:143708698-143708720 GCTCCTCCTGAGGACTGTTGGGG + Intergenic
983170816 4:164534554-164534576 TCTTCCACAGAGCACTGTGTAGG + Intergenic
985378682 4:189370204-189370226 TCTCCTCCAGAGCAAAGAAGTGG + Intergenic
987943839 5:24578049-24578071 TCTCCTCACCAGCACTGTGGTGG - Intronic
988551477 5:32204580-32204602 GCTCCTCCAGACCACTCTTGGGG + Intergenic
989757453 5:44973040-44973062 TCTTCTCTAGGGCACTGTGGTGG - Intergenic
998351491 5:141504863-141504885 CCTTCTCCAGAGGACTGTGAAGG - Intronic
1001773824 5:174314207-174314229 TCCCCTGCTGAGCACTGAGGAGG - Intergenic
1005811275 6:29518280-29518302 TGGCCTCCAGGGCACTGTGGAGG + Intergenic
1005950143 6:30625779-30625801 GCTCCTACAGAGCACTCTGAGGG - Exonic
1006474045 6:34243966-34243988 TGCCCTCCAGTGCAGTGTGGTGG - Intronic
1006682381 6:35806204-35806226 TCTTCTGCAGAGCACTGAGTAGG - Intronic
1007240402 6:40420697-40420719 TTTCCTCCAGTGCACATTGGAGG - Intronic
1012819661 6:104069980-104070002 TTACCTCCTGAGCACTGTGCTGG + Intergenic
1013649601 6:112181203-112181225 TCTTCTCTAGACCACTGTGGCGG + Intronic
1014264030 6:119253997-119254019 TCTCCTCCTGAGCTCTGATGAGG + Intronic
1022507472 7:30915858-30915880 CCTCCTCCAGAGCTCAGGGGAGG + Intronic
1024559813 7:50633190-50633212 TCTCCTACAGAGAAATGGGGAGG - Intronic
1026556442 7:71412627-71412649 TCACCTCCAGACCATTGTCGTGG + Intronic
1029438535 7:100575259-100575281 TCTCCTCCAGGGCACTGCCCGGG - Exonic
1029747653 7:102525386-102525408 TCGCCTCCAGAACCCTGTGCAGG + Intergenic
1029765604 7:102624476-102624498 TCGCCTCCAGAACCCTGTGCAGG + Intronic
1030079800 7:105767452-105767474 TCACCTCCAGAGGACTGAGTGGG - Intronic
1030252576 7:107463771-107463793 TATTCTGCAGAGGACTGTGGTGG + Intronic
1031248709 7:119351168-119351190 TCTCTTCCCCAGCAATGTGGGGG - Intergenic
1034559019 7:151867886-151867908 TCCCCTCCCCAGCACAGTGGAGG + Intronic
1036627562 8:10484118-10484140 TCTCCTCCAGCCCTCTGCGGTGG + Intergenic
1036673117 8:10806235-10806257 TCTCCTTCACTGCACAGTGGGGG + Intronic
1037422688 8:18720696-18720718 CCATCTGCAGAGCACTGTGGGGG - Intronic
1038459885 8:27706851-27706873 GCTACTTCAGAGCTCTGTGGGGG - Intergenic
1039794168 8:40898011-40898033 TCTCCTCCAGCCCAATGTGGGGG + Intergenic
1042514105 8:69641872-69641894 CCCCCTCCAGAGCACAGTGAGGG - Intronic
1043889778 8:85642952-85642974 GCTCATCCACAGCACCGTGGTGG - Intergenic
1043892389 8:85661697-85661719 GCTCATCCACAGCACCGTGGTGG - Intergenic
1043893168 8:85715638-85715660 GCTCATCCACAGCACCGTGGTGG + Intergenic
1043895855 8:85737092-85737114 GCTCATCCACAGCACCGTGGTGG + Intergenic
1043896824 8:85744716-85744738 GCTCATCCACAGCACCGTGGTGG - Intergenic
1043899147 8:85763082-85763104 GCTCATCCACAGCACCGTGGTGG - Intergenic
1043900758 8:85775277-85775299 GCTCATCCACAGCACCGTGGTGG - Intergenic
1043902722 8:85790552-85790574 GCTCATCCACAGCACCGTGGTGG - Intergenic
1043904332 8:85802745-85802767 GCTCATCCACAGCACCGTGGTGG - Intergenic
1043905944 8:85814939-85814961 GCTCATCCACAGCACCGTGGTGG - Intergenic
1043907552 8:85827126-85827148 GCTCATCCACAGCACCGTGGTGG - Intergenic
1044076542 8:87829031-87829053 TCTCCTTCAGAGCACCGAGAGGG + Intergenic
1044728032 8:95208671-95208693 TCTCTTCCTGAGGAATGTGGTGG - Intergenic
1046731331 8:117729635-117729657 TCACCTGGAGAGCAATGTGGAGG - Intergenic
1047874080 8:129115954-129115976 GCTCCTCCAGAGACCCGTGGAGG - Intergenic
1048857170 8:138695162-138695184 TCTCCTCCTGAGCCCTGTTATGG + Intronic
1049171957 8:141167033-141167055 GCTCCTCCTGATCACTGTGCTGG + Intronic
1049388179 8:142354751-142354773 TTTCCTCCAGCTCAGTGTGGAGG - Exonic
1049529408 8:143146932-143146954 TGTCTTCCAGAGCCCTCTGGAGG - Intergenic
1051731184 9:20144635-20144657 CATCCCCCAGTGCACTGTGGGGG + Intergenic
1052242993 9:26297270-26297292 TCTTCTCCAGAGCACTATTTAGG + Intergenic
1052863920 9:33453536-33453558 TCTCTTCCAGAGCATTGGAGTGG + Intergenic
1053168382 9:35860762-35860784 TCTCCTACAAAGCAATATGGAGG - Intergenic
1058760040 9:108121873-108121895 TCACCTCCAGAGCCCTGTGTTGG + Intergenic
1060735472 9:126064189-126064211 GCTCTCCCAGAGCACTCTGGAGG - Intergenic
1061357597 9:130118404-130118426 GCACCTCCTGTGCACTGTGGGGG + Intronic
1062530179 9:136996258-136996280 TCTCCTCCAGAAGACTGGGCTGG + Intronic
1187352847 X:18537039-18537061 TTCCCTCCAGCGCCCTGTGGTGG - Intronic
1190402518 X:50052578-50052600 TCTCTTCCAGAAAACTGTAGCGG - Intronic
1190562428 X:51698587-51698609 TTGCCTCCAGAGCATTGAGGTGG + Intergenic
1192023864 X:67427232-67427254 TCTACTTCAGACCACTGTGCTGG + Intergenic
1192198014 X:69044509-69044531 TCTCTTCCAGAACACTGAAGAGG - Intergenic
1193325853 X:80177947-80177969 CCTCCTTCATTGCACTGTGGTGG + Intergenic
1194746641 X:97635672-97635694 TCCTTTCCAGAGCCCTGTGGAGG + Intergenic
1195200986 X:102549920-102549942 TCTCCTCTACAGACCTGTGGGGG + Intergenic
1197188669 X:123620056-123620078 GTTCATCAAGAGCACTGTGGTGG - Intronic
1197994923 X:132362700-132362722 TATCCCCCAGAGCACTGAGAAGG - Intergenic
1198435798 X:136615771-136615793 GCTCCTACAGAACTCTGTGGCGG + Intergenic
1198943500 X:141984187-141984209 TTTCCTTCAGAGCACTATTGAGG - Intergenic
1201510962 Y:14762114-14762136 TCACCTACAGCGGACTGTGGTGG - Intronic