ID: 1146827908

View in Genome Browser
Species Human (GRCh38)
Location 17:36039919-36039941
Sequence CACCTGCAGTTCGAACACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146827908_1146827909 -7 Left 1146827908 17:36039919-36039941 CCAACGTGTTCGAACTGCAGGTG No data
Right 1146827909 17:36039935-36039957 GCAGGTGTGAGCCACTGCTCTGG No data
1146827908_1146827910 -6 Left 1146827908 17:36039919-36039941 CCAACGTGTTCGAACTGCAGGTG No data
Right 1146827910 17:36039936-36039958 CAGGTGTGAGCCACTGCTCTGGG 0: 36
1: 1057
2: 13913
3: 52077
4: 118052
1146827908_1146827912 18 Left 1146827908 17:36039919-36039941 CCAACGTGTTCGAACTGCAGGTG No data
Right 1146827912 17:36039960-36039982 TGTTTTCAAACTTACATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146827908 Original CRISPR CACCTGCAGTTCGAACACGT TGG (reversed) Intergenic
No off target data available for this crispr