ID: 1146827909

View in Genome Browser
Species Human (GRCh38)
Location 17:36039935-36039957
Sequence GCAGGTGTGAGCCACTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146827900_1146827909 26 Left 1146827900 17:36039886-36039908 CCTGGGCTCAAGCGATTCGCCCA No data
Right 1146827909 17:36039935-36039957 GCAGGTGTGAGCCACTGCTCTGG No data
1146827905_1146827909 -3 Left 1146827905 17:36039915-36039937 CCTCCCAACGTGTTCGAACTGCA No data
Right 1146827909 17:36039935-36039957 GCAGGTGTGAGCCACTGCTCTGG No data
1146827904_1146827909 3 Left 1146827904 17:36039909-36039931 CCTCGGCCTCCCAACGTGTTCGA No data
Right 1146827909 17:36039935-36039957 GCAGGTGTGAGCCACTGCTCTGG No data
1146827902_1146827909 7 Left 1146827902 17:36039905-36039927 CCCACCTCGGCCTCCCAACGTGT 0: 10
1: 2833
2: 51508
3: 208001
4: 279118
Right 1146827909 17:36039935-36039957 GCAGGTGTGAGCCACTGCTCTGG No data
1146827903_1146827909 6 Left 1146827903 17:36039906-36039928 CCACCTCGGCCTCCCAACGTGTT 0: 20
1: 5325
2: 104850
3: 195269
4: 134928
Right 1146827909 17:36039935-36039957 GCAGGTGTGAGCCACTGCTCTGG No data
1146827908_1146827909 -7 Left 1146827908 17:36039919-36039941 CCAACGTGTTCGAACTGCAGGTG No data
Right 1146827909 17:36039935-36039957 GCAGGTGTGAGCCACTGCTCTGG No data
1146827907_1146827909 -6 Left 1146827907 17:36039918-36039940 CCCAACGTGTTCGAACTGCAGGT No data
Right 1146827909 17:36039935-36039957 GCAGGTGTGAGCCACTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146827909 Original CRISPR GCAGGTGTGAGCCACTGCTC TGG Intergenic
No off target data available for this crispr