ID: 1146827910

View in Genome Browser
Species Human (GRCh38)
Location 17:36039936-36039958
Sequence CAGGTGTGAGCCACTGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185135
Summary {0: 36, 1: 1057, 2: 13913, 3: 52077, 4: 118052}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146827905_1146827910 -2 Left 1146827905 17:36039915-36039937 CCTCCCAACGTGTTCGAACTGCA No data
Right 1146827910 17:36039936-36039958 CAGGTGTGAGCCACTGCTCTGGG 0: 36
1: 1057
2: 13913
3: 52077
4: 118052
1146827903_1146827910 7 Left 1146827903 17:36039906-36039928 CCACCTCGGCCTCCCAACGTGTT 0: 20
1: 5325
2: 104850
3: 195269
4: 134928
Right 1146827910 17:36039936-36039958 CAGGTGTGAGCCACTGCTCTGGG 0: 36
1: 1057
2: 13913
3: 52077
4: 118052
1146827907_1146827910 -5 Left 1146827907 17:36039918-36039940 CCCAACGTGTTCGAACTGCAGGT No data
Right 1146827910 17:36039936-36039958 CAGGTGTGAGCCACTGCTCTGGG 0: 36
1: 1057
2: 13913
3: 52077
4: 118052
1146827908_1146827910 -6 Left 1146827908 17:36039919-36039941 CCAACGTGTTCGAACTGCAGGTG No data
Right 1146827910 17:36039936-36039958 CAGGTGTGAGCCACTGCTCTGGG 0: 36
1: 1057
2: 13913
3: 52077
4: 118052
1146827904_1146827910 4 Left 1146827904 17:36039909-36039931 CCTCGGCCTCCCAACGTGTTCGA No data
Right 1146827910 17:36039936-36039958 CAGGTGTGAGCCACTGCTCTGGG 0: 36
1: 1057
2: 13913
3: 52077
4: 118052
1146827902_1146827910 8 Left 1146827902 17:36039905-36039927 CCCACCTCGGCCTCCCAACGTGT 0: 10
1: 2833
2: 51508
3: 208001
4: 279118
Right 1146827910 17:36039936-36039958 CAGGTGTGAGCCACTGCTCTGGG 0: 36
1: 1057
2: 13913
3: 52077
4: 118052
1146827900_1146827910 27 Left 1146827900 17:36039886-36039908 CCTGGGCTCAAGCGATTCGCCCA No data
Right 1146827910 17:36039936-36039958 CAGGTGTGAGCCACTGCTCTGGG 0: 36
1: 1057
2: 13913
3: 52077
4: 118052

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146827910 Original CRISPR CAGGTGTGAGCCACTGCTCT GGG Intergenic
Too many off-targets to display for this crispr