ID: 1146827912

View in Genome Browser
Species Human (GRCh38)
Location 17:36039960-36039982
Sequence TGTTTTCAAACTTACATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146827908_1146827912 18 Left 1146827908 17:36039919-36039941 CCAACGTGTTCGAACTGCAGGTG No data
Right 1146827912 17:36039960-36039982 TGTTTTCAAACTTACATAAATGG No data
1146827905_1146827912 22 Left 1146827905 17:36039915-36039937 CCTCCCAACGTGTTCGAACTGCA No data
Right 1146827912 17:36039960-36039982 TGTTTTCAAACTTACATAAATGG No data
1146827904_1146827912 28 Left 1146827904 17:36039909-36039931 CCTCGGCCTCCCAACGTGTTCGA No data
Right 1146827912 17:36039960-36039982 TGTTTTCAAACTTACATAAATGG No data
1146827907_1146827912 19 Left 1146827907 17:36039918-36039940 CCCAACGTGTTCGAACTGCAGGT No data
Right 1146827912 17:36039960-36039982 TGTTTTCAAACTTACATAAATGG No data
1146827911_1146827912 -9 Left 1146827911 17:36039946-36039968 CCACTGCTCTGGGCTGTTTTCAA No data
Right 1146827912 17:36039960-36039982 TGTTTTCAAACTTACATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146827912 Original CRISPR TGTTTTCAAACTTACATAAA TGG Intergenic
No off target data available for this crispr