ID: 1146828744

View in Genome Browser
Species Human (GRCh38)
Location 17:36047856-36047878
Sequence ACTGAGAAGCAGGCAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146828736_1146828744 -4 Left 1146828736 17:36047837-36047859 CCCATCTCCCTCTTCCTACACTG No data
Right 1146828744 17:36047856-36047878 ACTGAGAAGCAGGCAATGGAGGG No data
1146828732_1146828744 29 Left 1146828732 17:36047804-36047826 CCTGTGCTACCTGGACATGCACA No data
Right 1146828744 17:36047856-36047878 ACTGAGAAGCAGGCAATGGAGGG No data
1146828737_1146828744 -5 Left 1146828737 17:36047838-36047860 CCATCTCCCTCTTCCTACACTGA No data
Right 1146828744 17:36047856-36047878 ACTGAGAAGCAGGCAATGGAGGG No data
1146828733_1146828744 20 Left 1146828733 17:36047813-36047835 CCTGGACATGCACAAAAGTCAGG No data
Right 1146828744 17:36047856-36047878 ACTGAGAAGCAGGCAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146828744 Original CRISPR ACTGAGAAGCAGGCAATGGA GGG Intergenic
No off target data available for this crispr