ID: 1146832399

View in Genome Browser
Species Human (GRCh38)
Location 17:36081508-36081530
Sequence CCTGGGGTCTGCAGGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146832399_1146832414 30 Left 1146832399 17:36081508-36081530 CCTGGTTCCCTGCAGACCCCAGG No data
Right 1146832414 17:36081561-36081583 CCTGTGTCCCACCACCAGATAGG No data
1146832399_1146832407 1 Left 1146832399 17:36081508-36081530 CCTGGTTCCCTGCAGACCCCAGG No data
Right 1146832407 17:36081532-36081554 CAGGCCAGAAAACACCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146832399 Original CRISPR CCTGGGGTCTGCAGGGAACC AGG (reversed) Intergenic
No off target data available for this crispr