ID: 1146833215

View in Genome Browser
Species Human (GRCh38)
Location 17:36088624-36088646
Sequence CGACCTCGGTGGGCCCAGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146833215_1146833223 -3 Left 1146833215 17:36088624-36088646 CCCCACTGGGCCCACCGAGGTCG 0: 1
1: 1
2: 1
3: 5
4: 90
Right 1146833223 17:36088644-36088666 TCGCTGGGCCTCGAAGCTTCTGG 0: 2
1: 0
2: 0
3: 4
4: 86
1146833215_1146833227 21 Left 1146833215 17:36088624-36088646 CCCCACTGGGCCCACCGAGGTCG 0: 1
1: 1
2: 1
3: 5
4: 90
Right 1146833227 17:36088668-36088690 CCCCTCAGGCACTCAGCTCCAGG 0: 2
1: 0
2: 3
3: 33
4: 318
1146833215_1146833225 7 Left 1146833215 17:36088624-36088646 CCCCACTGGGCCCACCGAGGTCG 0: 1
1: 1
2: 1
3: 5
4: 90
Right 1146833225 17:36088654-36088676 TCGAAGCTTCTGGACCCCTCAGG 0: 2
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146833215 Original CRISPR CGACCTCGGTGGGCCCAGTG GGG (reversed) Exonic
900532199 1:3160158-3160180 AGAGCTGGGTGGGCCCTGTGGGG + Intronic
900615706 1:3564806-3564828 GGACCTGGGTGGGCCCAGATGGG - Intronic
906538812 1:46569208-46569230 CCACCTCGCTAGGCCCACTGAGG + Intronic
907186333 1:52612185-52612207 TGGCCTTGGTGGGCACAGTGAGG - Intergenic
915333050 1:155125554-155125576 CGGGCTCGCTGGGCCCAGTCTGG - Intergenic
921270588 1:213465906-213465928 CGACCTCGGTATGGGCAGTGGGG - Intergenic
1068805172 10:61187106-61187128 GTACCTCGTTGGGGCCAGTGGGG - Intergenic
1068955726 10:62817629-62817651 ACACCTCGGTGAGCCCAGCGCGG + Intronic
1069745638 10:70713299-70713321 CTACCTCTGTGGGCCCTCTGTGG + Intronic
1073729195 10:106270039-106270061 CCTCCTGGGTGGACCCAGTGAGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1078240787 11:9529456-9529478 CAGCCTGGCTGGGCCCAGTGGGG - Intergenic
1088691450 11:112331978-112332000 CCACTGTGGTGGGCCCAGTGGGG + Intergenic
1089568854 11:119389091-119389113 AGACCACGATGGGGCCAGTGAGG - Intergenic
1103007136 12:117430275-117430297 GGCCCTCAGTGAGCCCAGTGTGG - Intronic
1108323211 13:49306163-49306185 TCACCACTGTGGGCCCAGTGTGG + Intergenic
1110751453 13:79120039-79120061 CGACCTCGGTCAGCCCAGGAGGG + Intergenic
1114401734 14:22416414-22416436 CTCCCCCGGTGGTCCCAGTGTGG + Intergenic
1121778857 14:96608821-96608843 CCACCTCCGTGGCCACAGTGAGG - Intergenic
1124061638 15:26298481-26298503 CGACCTCGGCCAGCCCAGAGCGG + Intergenic
1137669186 16:50269462-50269484 GGACTTCGCTGGGCCCACTGCGG + Intronic
1138204366 16:55114137-55114159 TGACCTCGGTGGACCAAGTTAGG - Intergenic
1139806239 16:69566734-69566756 CGATCGCGGTGGCCCCAGCGCGG - Intronic
1140487522 16:75305430-75305452 AGACCTCTGTGGGCTCTGTGTGG + Intronic
1141659987 16:85436594-85436616 GGACCTCGGTAGCCCCAGTGGGG + Intergenic
1146833215 17:36088624-36088646 CGACCTCGGTGGGCCCAGTGGGG - Exonic
1146847734 17:36195238-36195260 CGACCTCAGTGGGCCCAGTGGGG - Exonic
1147122398 17:38343420-38343442 CGACATCCGTGAGTCCAGTGTGG - Exonic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1154305669 18:13229097-13229119 CCTCCTCGGTGGGTCCAATGGGG - Intronic
1160447541 18:78939352-78939374 CGTCTGCGGTGGGGCCAGTGTGG - Intergenic
1161261465 19:3340125-3340147 GGACCTCCGTGGGCTCTGTGGGG + Intergenic
1161493596 19:4575804-4575826 CTACCCCGCTGGGCTCAGTGAGG - Intergenic
1162520077 19:11174458-11174480 CGACAGCGGTGAGCCCAGCGGGG - Exonic
1163575607 19:18109527-18109549 AGGCCCCGGTGGACCCAGTGGGG - Intronic
1165077373 19:33287308-33287330 GGACCTCTGTCAGCCCAGTGAGG - Intergenic
1165544505 19:36523248-36523270 AGACCTTGGTGGTCACAGTGAGG - Intronic
1168605883 19:57759594-57759616 CGACCTCGGTTGCCCAGGTGGGG + Intergenic
925359422 2:3267120-3267142 CCACCTCAGAGGGCCCAGTGGGG + Intronic
925900005 2:8502512-8502534 CGACCCCAGTGGGGGCAGTGTGG + Intergenic
927511208 2:23644810-23644832 GGCCCTCGGTCTGCCCAGTGGGG - Intronic
931430995 2:62208943-62208965 CAACCTGGGTGGGGGCAGTGGGG + Intronic
934657603 2:96124155-96124177 CGACCCCAGTGGTTCCAGTGCGG - Exonic
937083059 2:119154103-119154125 GGACCTCGGTGGGCCATGAGGGG + Intergenic
943289535 2:186051052-186051074 TGACCTCGGTGGGTCTAGTGAGG + Intergenic
948293201 2:236842647-236842669 CCACCTCGGTGGCCCACGTGTGG + Intergenic
948371239 2:237490240-237490262 CGACCTCCATGGGCTCAGGGAGG - Intronic
948566600 2:238891329-238891351 CGCCCTCACTGTGCCCAGTGGGG + Intronic
1170824120 20:19778775-19778797 GGACCTCGGAGGGCCCTGTGGGG + Intergenic
1173864837 20:46307357-46307379 AGCCCTGGGTGGGCACAGTGTGG - Intronic
1173900399 20:46583531-46583553 GGGTCTCGGTGGGCTCAGTGAGG - Intronic
1175766199 20:61594401-61594423 AGACCCAGGTGGGCCCGGTGGGG - Intronic
1175775272 20:61649221-61649243 CGTGCTCGGGGGGCCCTGTGGGG - Intronic
1176091543 20:63320604-63320626 CCACCTCTGTGGGCCCAGCCAGG + Intronic
1179920478 21:44504478-44504500 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1179920492 21:44504525-44504547 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1179920504 21:44504572-44504594 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1179920516 21:44504619-44504641 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1179920528 21:44504666-44504688 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1179920540 21:44504713-44504735 CGGCCTCGGTGAGCCCACAGTGG + Intronic
1181049813 22:20233191-20233213 ACACCCCGGTGGGCCCAGGGAGG + Intergenic
1183524795 22:38316876-38316898 GGGCCTCGGAGGGCCCAGCGGGG + Intronic
950337759 3:12211993-12212015 CTACCTCGGTGTCCCAAGTGTGG - Intergenic
954374010 3:50184841-50184863 CGCACCCGGTGGGCCCAGCGTGG - Intronic
966766669 3:183469277-183469299 AGACCAGGGTGTGCCCAGTGAGG - Intergenic
968224705 3:196966544-196966566 CAGCCTGGGTGGGCCCACTGGGG + Intronic
971030700 4:22634640-22634662 CGGCCTCGGCCGGCCCAGGGAGG - Intergenic
971153387 4:24057795-24057817 CGAGCTGAGTAGGCCCAGTGTGG + Intergenic
972360993 4:38325327-38325349 CGACCTCGGCCAGCCCAGAGAGG + Intergenic
985303607 4:188515073-188515095 CGGCCTTGGTGGGCCCACAGTGG - Intergenic
995206705 5:109488220-109488242 CGACCTCGGCCAGCCCAGAGAGG + Intergenic
998176440 5:139904632-139904654 CTACCTCGGTGGGCCCAGGGAGG - Intronic
998261657 5:140636283-140636305 CCACCTTGCTGGGCCAAGTGTGG + Intergenic
1002616390 5:180459117-180459139 CGGCCTCGGCCGGCCCAGAGAGG - Intergenic
1006342596 6:33454716-33454738 AGACCTCTGTGGGCACTGTGAGG + Exonic
1006348430 6:33502662-33502684 CGACCTCGGCCAGCCCAGAGAGG - Intergenic
1006717632 6:36130550-36130572 CGATCTCGGCGGCCCCAGCGTGG - Exonic
1018616123 6:165688512-165688534 CAATCTCCATGGGCCCAGTGGGG + Intronic
1023232455 7:38049719-38049741 CGGCCTCGGTCAGCCCAGAGAGG - Intergenic
1025021718 7:55485661-55485683 CGCCCTGTGTGGGCCCTGTGTGG - Intronic
1028857159 7:95605349-95605371 CGACCTCGGCCAGCCCAGAGAGG - Intergenic
1031395878 7:121273230-121273252 CCATCTTGGTGGGCCGAGTGTGG + Intronic
1034306643 7:150049040-150049062 CGCTCTCGGCGGGCACAGTGAGG - Intergenic
1034800202 7:154051603-154051625 CGCTCTCGGCGGGCACAGTGAGG + Intronic
1035781135 8:2229160-2229182 CAGCCTCTGTGGGCTCAGTGGGG + Intergenic
1037506817 8:19538846-19538868 TGACCTTGGTAGGCTCAGTGAGG - Intronic
1038765405 8:30423408-30423430 CTACCTCGGAGGGGACAGTGAGG + Intronic
1048538419 8:135319299-135319321 CGACCACGTTGAGCTCAGTGTGG - Intergenic
1054925936 9:70588794-70588816 GGCCCTGGATGGGCCCAGTGGGG - Intronic
1059129078 9:111725495-111725517 CGCCCTCCCTGGACCCAGTGGGG - Intronic
1062395715 9:136351832-136351854 TGACCTCGGTAAGGCCAGTGGGG - Intronic
1062591450 9:137276580-137276602 CGGCCTCTGTGGGACCAGAGCGG - Intergenic
1190430442 X:50373374-50373396 CCACCTCATAGGGCCCAGTGAGG - Intronic
1190626717 X:52344160-52344182 CTACCTCTGTGGCCCCAGTATGG - Intergenic
1190701291 X:52991669-52991691 CTACCTCTGTGGCCCCAGTATGG + Intronic
1192433746 X:71129598-71129620 CTACCTCTGTGGGCCCAGGGTGG + Intronic
1202186192 Y:22186575-22186597 CCTCCTCTGTGAGCCCAGTGTGG - Intergenic
1202205167 Y:22399821-22399843 CCTCCTCTGTGAGCCCAGTGTGG + Intronic