ID: 1146833701

View in Genome Browser
Species Human (GRCh38)
Location 17:36092377-36092399
Sequence AGGCAGAGGGTGGGGTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146833701_1146833714 29 Left 1146833701 17:36092377-36092399 CCTTCTCACCCCACCCTCTGCCT No data
Right 1146833714 17:36092429-36092451 TTCCCTCACTCACTTCTTAGGGG No data
1146833701_1146833712 27 Left 1146833701 17:36092377-36092399 CCTTCTCACCCCACCCTCTGCCT No data
Right 1146833712 17:36092427-36092449 CATTCCCTCACTCACTTCTTAGG No data
1146833701_1146833713 28 Left 1146833701 17:36092377-36092399 CCTTCTCACCCCACCCTCTGCCT No data
Right 1146833713 17:36092428-36092450 ATTCCCTCACTCACTTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146833701 Original CRISPR AGGCAGAGGGTGGGGTGAGA AGG (reversed) Intergenic