ID: 1146833707

View in Genome Browser
Species Human (GRCh38)
Location 17:36092397-36092419
Sequence GGGTATCACTGAGAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146833707_1146833713 8 Left 1146833707 17:36092397-36092419 CCTCCCAGCTCTCAGTGATACCC No data
Right 1146833713 17:36092428-36092450 ATTCCCTCACTCACTTCTTAGGG No data
1146833707_1146833714 9 Left 1146833707 17:36092397-36092419 CCTCCCAGCTCTCAGTGATACCC No data
Right 1146833714 17:36092429-36092451 TTCCCTCACTCACTTCTTAGGGG No data
1146833707_1146833712 7 Left 1146833707 17:36092397-36092419 CCTCCCAGCTCTCAGTGATACCC No data
Right 1146833712 17:36092427-36092449 CATTCCCTCACTCACTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146833707 Original CRISPR GGGTATCACTGAGAGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr