ID: 1146833714

View in Genome Browser
Species Human (GRCh38)
Location 17:36092429-36092451
Sequence TTCCCTCACTCACTTCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146833709_1146833714 5 Left 1146833709 17:36092401-36092423 CCAGCTCTCAGTGATACCCAGAA No data
Right 1146833714 17:36092429-36092451 TTCCCTCACTCACTTCTTAGGGG No data
1146833708_1146833714 6 Left 1146833708 17:36092400-36092422 CCCAGCTCTCAGTGATACCCAGA No data
Right 1146833714 17:36092429-36092451 TTCCCTCACTCACTTCTTAGGGG No data
1146833704_1146833714 19 Left 1146833704 17:36092387-36092409 CCACCCTCTGCCTCCCAGCTCTC No data
Right 1146833714 17:36092429-36092451 TTCCCTCACTCACTTCTTAGGGG No data
1146833702_1146833714 21 Left 1146833702 17:36092385-36092407 CCCCACCCTCTGCCTCCCAGCTC No data
Right 1146833714 17:36092429-36092451 TTCCCTCACTCACTTCTTAGGGG No data
1146833706_1146833714 15 Left 1146833706 17:36092391-36092413 CCTCTGCCTCCCAGCTCTCAGTG No data
Right 1146833714 17:36092429-36092451 TTCCCTCACTCACTTCTTAGGGG No data
1146833705_1146833714 16 Left 1146833705 17:36092390-36092412 CCCTCTGCCTCCCAGCTCTCAGT No data
Right 1146833714 17:36092429-36092451 TTCCCTCACTCACTTCTTAGGGG No data
1146833701_1146833714 29 Left 1146833701 17:36092377-36092399 CCTTCTCACCCCACCCTCTGCCT No data
Right 1146833714 17:36092429-36092451 TTCCCTCACTCACTTCTTAGGGG No data
1146833707_1146833714 9 Left 1146833707 17:36092397-36092419 CCTCCCAGCTCTCAGTGATACCC No data
Right 1146833714 17:36092429-36092451 TTCCCTCACTCACTTCTTAGGGG No data
1146833703_1146833714 20 Left 1146833703 17:36092386-36092408 CCCACCCTCTGCCTCCCAGCTCT No data
Right 1146833714 17:36092429-36092451 TTCCCTCACTCACTTCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146833714 Original CRISPR TTCCCTCACTCACTTCTTAG GGG Intergenic
No off target data available for this crispr