ID: 1146835929

View in Genome Browser
Species Human (GRCh38)
Location 17:36110647-36110669
Sequence CTGCCTAAACAGGTCTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146835926_1146835929 13 Left 1146835926 17:36110611-36110633 CCTATTTGATTTATATTAGCTCT No data
Right 1146835929 17:36110647-36110669 CTGCCTAAACAGGTCTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146835929 Original CRISPR CTGCCTAAACAGGTCTACCT TGG Intergenic
No off target data available for this crispr