ID: 1146836352

View in Genome Browser
Species Human (GRCh38)
Location 17:36113973-36113995
Sequence AGTTATCTGAACAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146836352_1146836357 16 Left 1146836352 17:36113973-36113995 CCTGCCATCTTGTTCAGATAACT No data
Right 1146836357 17:36114012-36114034 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1146836352_1146836356 15 Left 1146836352 17:36113973-36113995 CCTGCCATCTTGTTCAGATAACT No data
Right 1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1146836352_1146836354 4 Left 1146836352 17:36113973-36113995 CCTGCCATCTTGTTCAGATAACT No data
Right 1146836354 17:36114000-36114022 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1146836352_1146836358 22 Left 1146836352 17:36113973-36113995 CCTGCCATCTTGTTCAGATAACT No data
Right 1146836358 17:36114018-36114040 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1146836352_1146836359 25 Left 1146836352 17:36113973-36113995 CCTGCCATCTTGTTCAGATAACT No data
Right 1146836359 17:36114021-36114043 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146836352 Original CRISPR AGTTATCTGAACAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr