ID: 1146840066

View in Genome Browser
Species Human (GRCh38)
Location 17:36145439-36145461
Sequence TGGTGAACAATATTTCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146840058_1146840066 21 Left 1146840058 17:36145395-36145417 CCTCCAGTAAAAATCTTCAACTC No data
Right 1146840066 17:36145439-36145461 TGGTGAACAATATTTCACATGGG No data
1146840062_1146840066 -1 Left 1146840062 17:36145417-36145439 CCTAGGCTCAGGCAAACTTTCCT No data
Right 1146840066 17:36145439-36145461 TGGTGAACAATATTTCACATGGG No data
1146840059_1146840066 18 Left 1146840059 17:36145398-36145420 CCAGTAAAAATCTTCAACTCCTA No data
Right 1146840066 17:36145439-36145461 TGGTGAACAATATTTCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146840066 Original CRISPR TGGTGAACAATATTTCACAT GGG Intergenic
No off target data available for this crispr