ID: 1146841377

View in Genome Browser
Species Human (GRCh38)
Location 17:36157734-36157756
Sequence CACTTAACTCTGCTGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146841375_1146841377 -4 Left 1146841375 17:36157715-36157737 CCATAGATTTCTGGTGCAACACT No data
Right 1146841377 17:36157734-36157756 CACTTAACTCTGCTGTTGCAGGG No data
1146841372_1146841377 26 Left 1146841372 17:36157685-36157707 CCAAAGGGTAGATATTTTAAACT No data
Right 1146841377 17:36157734-36157756 CACTTAACTCTGCTGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146841377 Original CRISPR CACTTAACTCTGCTGTTGCA GGG Intergenic
No off target data available for this crispr