ID: 1146841894

View in Genome Browser
Species Human (GRCh38)
Location 17:36162033-36162055
Sequence TTCTCCTAAGAGGAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146841894_1146841899 10 Left 1146841894 17:36162033-36162055 CCTGCACACTCCTCTTAGGAGAA No data
Right 1146841899 17:36162066-36162088 GGAGAAATTGCAGTTCAGGAAGG No data
1146841894_1146841898 6 Left 1146841894 17:36162033-36162055 CCTGCACACTCCTCTTAGGAGAA No data
Right 1146841898 17:36162062-36162084 AGATGGAGAAATTGCAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146841894 Original CRISPR TTCTCCTAAGAGGAGTGTGC AGG (reversed) Intergenic
No off target data available for this crispr