ID: 1146842591

View in Genome Browser
Species Human (GRCh38)
Location 17:36166241-36166263
Sequence ACCTGGACGTAGAGGGGCCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 11, 2: 2, 3: 15, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146842591_1146842602 -2 Left 1146842591 17:36166241-36166263 CCAAGGCCCCTCTACGTCCAGGT 0: 1
1: 11
2: 2
3: 15
4: 113
Right 1146842602 17:36166262-36166284 GTCCGTTGGGAGGCGGGGCATGG 0: 12
1: 2
2: 0
3: 16
4: 281
1146842591_1146842600 -7 Left 1146842591 17:36166241-36166263 CCAAGGCCCCTCTACGTCCAGGT 0: 1
1: 11
2: 2
3: 15
4: 113
Right 1146842600 17:36166257-36166279 TCCAGGTCCGTTGGGAGGCGGGG 0: 12
1: 3
2: 0
3: 5
4: 150
1146842591_1146842605 22 Left 1146842591 17:36166241-36166263 CCAAGGCCCCTCTACGTCCAGGT 0: 1
1: 11
2: 2
3: 15
4: 113
Right 1146842605 17:36166286-36166308 GTTCCACTGCAGGAATCTCCAGG 0: 15
1: 0
2: 3
3: 12
4: 116
1146842591_1146842604 12 Left 1146842591 17:36166241-36166263 CCAAGGCCCCTCTACGTCCAGGT 0: 1
1: 11
2: 2
3: 15
4: 113
Right 1146842604 17:36166276-36166298 GGGGCATGGAGTTCCACTGCAGG 0: 14
1: 0
2: 6
3: 15
4: 156
1146842591_1146842598 -9 Left 1146842591 17:36166241-36166263 CCAAGGCCCCTCTACGTCCAGGT 0: 1
1: 11
2: 2
3: 15
4: 113
Right 1146842598 17:36166255-36166277 CGTCCAGGTCCGTTGGGAGGCGG 0: 12
1: 2
2: 0
3: 5
4: 69
1146842591_1146842599 -8 Left 1146842591 17:36166241-36166263 CCAAGGCCCCTCTACGTCCAGGT 0: 1
1: 11
2: 2
3: 15
4: 113
Right 1146842599 17:36166256-36166278 GTCCAGGTCCGTTGGGAGGCGGG 0: 12
1: 2
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146842591 Original CRISPR ACCTGGACGTAGAGGGGCCT TGG (reversed) Exonic
900201924 1:1411894-1411916 ACCGGGACCTAGACGGACCTGGG - Intergenic
900293815 1:1938676-1938698 ACCTGGGTGCAGAGAGGCCTGGG - Intronic
900413063 1:2521835-2521857 ACCAGGACACAGCGGGGCCTGGG + Intronic
901377086 1:8847280-8847302 ACCTGGAAGTATAGAGACCTAGG - Intergenic
903403993 1:23081028-23081050 TCCTGGGCTTGGAGGGGCCTGGG + Intronic
905171406 1:36111931-36111953 ACCTGGAGGTACAGGGCACTTGG - Intronic
906253574 1:44330443-44330465 ATTTGGATGTAGAGGTGCCTTGG - Intronic
906895372 1:49764561-49764583 ATCAGGACGTCTAGGGGCCTGGG + Intronic
908957895 1:69657487-69657509 ACCTGGATGAAGAGGATCCTTGG - Intronic
912458851 1:109818076-109818098 ACCTGGACTCAGATGGGGCTGGG + Intergenic
915838931 1:159200137-159200159 ACCTGGAGGTAGAGCAGCATGGG - Intronic
916733865 1:167589903-167589925 ACCTGATCACAGAGGGGCCTGGG - Intergenic
923550598 1:234960014-234960036 AGATGGATGTGGAGGGGCCTGGG - Intergenic
924503030 1:244653809-244653831 TTCTGGACTTAGAGGGGCTTGGG - Intronic
1063414234 10:5860175-5860197 ATCTGGACCTAGGGGAGCCTGGG - Intergenic
1066186681 10:33016275-33016297 AGCTTGACTTAGAGGGGACTTGG - Intergenic
1070596176 10:77834634-77834656 ACCTGGCTGTGGAGGGGCCTGGG + Intronic
1071103055 10:82061520-82061542 AGCTGGAGGTAGAGGGGACCAGG - Intronic
1071526978 10:86364780-86364802 ATCTGAACGTGGAGGCGCCTAGG - Intronic
1074528016 10:114278251-114278273 TCATGGAGGTAGAGGGGCCCAGG + Intronic
1074892427 10:117746725-117746747 ACCTGGCTGTAGAAGGGGCTGGG + Intergenic
1076443677 10:130497513-130497535 ACCTGGACGTTGTGGGGAGTAGG + Intergenic
1076994111 11:289991-290013 AGCCGGACGTTGAGGGGGCTGGG - Exonic
1077162034 11:1118133-1118155 ACCTGCATGGGGAGGGGCCTTGG + Intergenic
1080858272 11:36130860-36130882 ACTTGGACTGAGAGAGGCCTGGG - Intronic
1083448774 11:62728428-62728450 ACCTGGAAGTAGAAGGGAGTGGG - Intronic
1083778334 11:64905638-64905660 ACTGGGAGGTAGAGTGGCCTGGG + Exonic
1084174757 11:67417459-67417481 ACCTGGAGGAAGAGGGCCCCTGG + Exonic
1087102812 11:94381422-94381444 GCCTGGATGTTGGGGGGCCTGGG + Intronic
1090190191 11:124762053-124762075 ACCCGGACCTGGAGGGGACTTGG - Intronic
1091408194 12:221760-221782 AGCTGCACGTAGAGGTGCCCAGG - Intronic
1091999446 12:5020348-5020370 ACCTGGCCGTAGAGGAGTCAGGG - Intergenic
1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG + Exonic
1103581524 12:121918795-121918817 ACCTGGCCCTTGTGGGGCCTGGG + Intronic
1113325740 13:109279462-109279484 ACTTGGATTTAAAGGGGCCTGGG + Intergenic
1114611045 14:24040704-24040726 ACCTGGAAGTAGAGGGGCATGGG + Intergenic
1117454368 14:55883035-55883057 ATCTGGACCCAGAGGTGCCTCGG + Intergenic
1118796839 14:69152262-69152284 ACCCGGACGCCGAGGGGCCGGGG - Intronic
1120043988 14:79785942-79785964 ACCTGGAGGTAAAGGGCACTTGG - Intronic
1120841769 14:89091843-89091865 ACCTGGACATAAGGGGGTCTGGG + Intergenic
1122822424 14:104354288-104354310 CCCTGGAGATAGAGGGGCCCTGG + Intergenic
1123886581 15:24733109-24733131 AAGCGGAGGTAGAGGGGCCTGGG - Intergenic
1127775666 15:62262375-62262397 ATCTGGACGTAAGAGGGCCTGGG - Intergenic
1127821361 15:62658900-62658922 ACCAAGAGCTAGAGGGGCCTTGG + Intronic
1131998665 15:98158217-98158239 ACCTGGAGGTAGAGGGGCTCAGG + Intergenic
1139949762 16:70663196-70663218 TCCTGGAGGGAGAGGGGCCTGGG + Exonic
1143206014 17:5139555-5139577 ACCTGGATATAGGGGGCCCTTGG + Exonic
1143268082 17:5655479-5655501 CCCTGGAGGCAGAGAGGCCTGGG + Intergenic
1143954636 17:10658745-10658767 ACCTGGAGGGAGAGGGGCAGTGG - Intergenic
1145761906 17:27430078-27430100 ACCTGGATGTGGGGGGCCCTTGG + Intergenic
1146842591 17:36166241-36166263 ACCTGGACGTAGAGGGGCCTTGG - Exonic
1146854904 17:36254200-36254222 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146865716 17:36334176-36334198 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1146870804 17:36378092-36378114 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146878163 17:36429174-36429196 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146882112 17:36450320-36450342 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1147073688 17:37978716-37978738 ACCTGGACGTAGAGGGCCCTTGG - Intronic
1147080108 17:38014325-38014347 ACCTGGACGTAGAGGGCCCTTGG + Intronic
1147085209 17:38058254-38058276 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG + Intergenic
1147101156 17:38182220-38182242 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1149845753 17:60008726-60008748 ACCTGGACGTAGGGGACCCTTGG - Intergenic
1150084101 17:62265306-62265328 ACCTGGACGTAGGGGACCCTTGG - Intergenic
1152394478 17:80023972-80023994 ACCTCGTCCTGGAGGGGCCTGGG - Intronic
1152525227 17:80884622-80884644 TCCTGGACGCAGAGGGGCATGGG - Intronic
1156478772 18:37423251-37423273 ACCTGGACGTGGATGAGCCAAGG - Intronic
1156502546 18:37568615-37568637 ACTTGGACCTAGGGGTGCCTTGG - Intergenic
1158267683 18:55678092-55678114 CCCTGGATGTAGAGGGTGCTGGG + Intergenic
1161394450 19:4037805-4037827 ACGAGGACGAAGAGGGGCCCCGG + Exonic
1164412898 19:28020599-28020621 ACGTGGACTTGGAGGGGCCGGGG - Intergenic
1164539112 19:29109120-29109142 ACATGGTCGGAGAGGAGCCTGGG + Intergenic
1165432180 19:35779113-35779135 ACCTGGATGGAGGTGGGCCTGGG + Exonic
1166544427 19:43625720-43625742 ACCTGGACGAATAGGGATCTGGG - Intronic
1167147945 19:47694141-47694163 ACGGGGACGAAGAGGGGCCTGGG - Exonic
1167307748 19:48719051-48719073 ACCTGGACGGAGAGGGGGCAGGG + Exonic
925376437 2:3389240-3389262 ACCTGGGCCGAGAGAGGCCTGGG - Intronic
928215269 2:29356070-29356092 CCTTGGACCTCGAGGGGCCTTGG - Intronic
928231069 2:29499496-29499518 ACCTGAACGTAGAAGACCCTAGG - Intronic
933260843 2:80129500-80129522 ACCTGGCCCTAGAGGTGTCTAGG - Intronic
937315516 2:120929816-120929838 ACCTGCAGGTGGAGGGGCCCTGG - Intronic
938299952 2:130203329-130203351 AGCTGGACCCAGAGAGGCCTGGG + Intergenic
938456761 2:131471160-131471182 AGCTGGACCCAGAGAGGCCTGGG - Intronic
941863435 2:170308921-170308943 AATAGGAAGTAGAGGGGCCTGGG + Intronic
947382743 2:229560858-229560880 ACCAGGAGGTAAAGGGGCCGGGG + Intronic
948652605 2:239457792-239457814 AAATGGACATGGAGGGGCCTGGG + Intergenic
948870231 2:240794120-240794142 TCCTGGAGGTTGAGGGGCCAGGG - Intronic
948922016 2:241070270-241070292 ACCTGGCCCTGCAGGGGCCTGGG + Intronic
949035692 2:241814844-241814866 ACCAGGACGTCCAGGGACCTGGG - Intronic
1171143772 20:22764589-22764611 ACCTGGACGGCGTGAGGCCTGGG + Intergenic
1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG + Intronic
1173356961 20:42302545-42302567 ACCTGGAGGTAGAGGGGATGAGG - Intronic
1183339977 22:37274602-37274624 ACGTGCACGAAGAGGGGCCCTGG - Intergenic
1184230112 22:43154073-43154095 ACCTGGCCATCGAGTGGCCTGGG - Intronic
949368640 3:3310453-3310475 AGCTGGAGGCAGAGGGACCTCGG - Intergenic
949819662 3:8102733-8102755 ACCTGTAAGTAGAGTGGCATGGG + Intergenic
954383126 3:50230142-50230164 TCCTGGACGAAGAGAGGCCTGGG + Intronic
961394743 3:126578896-126578918 ACCTAGAGGAAGAGAGGCCTGGG + Intronic
968662798 4:1805746-1805768 ACCAGCACGTACAGGGGCCCTGG - Exonic
968693664 4:2009486-2009508 ACCTGCACGGAGAGGAGCCGCGG + Exonic
969367891 4:6709961-6709983 GCGTGCACGTAAAGGGGCCTCGG + Intergenic
969373229 4:6747223-6747245 ACCTGGACGCTGAGGGCCCTTGG - Intergenic
969838880 4:9865996-9866018 ACCTGGAGGCAGAGGGGTCCTGG - Intronic
982288935 4:153760532-153760554 CCCTGGAGGTAGAGGGGCAAAGG - Intergenic
985639052 5:1054642-1054664 CCCTGGACGCAGAGGGGCGGCGG + Intronic
997426520 5:133806643-133806665 AGCTCGACGTTCAGGGGCCTCGG + Intergenic
998385296 5:141753808-141753830 ACCTGCTCTTAGAGGGGCGTGGG + Intergenic
1001926376 5:175640098-175640120 ACCTGGACACAGAGAGGGCTAGG - Intergenic
1002046290 5:176543359-176543381 ACCGGGCCGGAGAGGGGCCGCGG - Intronic
1006290394 6:33130957-33130979 GCCAGGAGGTAGAGGGGTCTTGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006369588 6:33635738-33635760 TCCTGGAGGTAGAGGGTTCTGGG + Intronic
1007506950 6:42342951-42342973 ACCTGGCCCCAGAGAGGCCTTGG - Intronic
1010110169 6:72218254-72218276 ACCTGGACGCAGAGAGGCACTGG + Intronic
1011300171 6:85865349-85865371 ATCTGGAAAAAGAGGGGCCTGGG - Intergenic
1011724256 6:90193045-90193067 ACCTGGAGGTGAAGTGGCCTGGG - Intronic
1011745415 6:90403313-90403335 ACCTGGACATGGAGGGGCATTGG - Intergenic
1012835165 6:104255422-104255444 GCCTGGACATTGAGAGGCCTTGG + Intergenic
1015198526 6:130552061-130552083 ACCTGGTCCTAGAGAAGCCTTGG - Intergenic
1016738014 6:147501289-147501311 ACCTGGACATACAGGAGCCCCGG - Intergenic
1020254830 7:6497308-6497330 AGCCGGATGTAGAGGGGCCCTGG - Intergenic
1023880799 7:44320230-44320252 ACCTAGAGGTAGGGGGCCCTTGG + Intronic
1024053370 7:45644230-45644252 AGCTGGCCCTAGAGCGGCCTGGG + Intronic
1026455405 7:70568005-70568027 ACCTGGAGATAGAGGTGCTTAGG + Intronic
1027859378 7:83556507-83556529 ACCTAGACATTGAGGGGCCAGGG + Intronic
1029368370 7:100131093-100131115 GCCTGGAGGTAGTGGGGCCGGGG - Intergenic
1034470165 7:151250585-151250607 TCCTGGAGGAAGTGGGGCCTGGG - Intronic
1037583596 8:20261451-20261473 ACCAGGACGGGGAGGGGCCCGGG + Intronic
1042590568 8:70393874-70393896 GCCTGGACGTTGAAGGGCATTGG - Intronic
1042652667 8:71060368-71060390 GCCTGGAAGTAGAGTAGCCTTGG - Intergenic
1045856928 8:106775232-106775254 ACCTGGACATTGACTGGCCTTGG - Intergenic
1049639880 8:143710697-143710719 CCCTGGACGTGGCGTGGCCTGGG - Intronic
1051418822 9:16870834-16870856 ACCTGAGCGCAGAGGGGCCGCGG - Intronic
1052930025 9:34048645-34048667 GCCTGGACGTAGAGGGACCGTGG + Intronic
1057261874 9:93589078-93589100 CCCTGGACCTTGAGGGTCCTGGG - Intronic
1062020864 9:134318826-134318848 TCCTGGACTTTGAGGGGCCCAGG - Intronic
1062359510 9:136180881-136180903 TCCTGGGCGGAGAGGGGCCTGGG + Intergenic
1062640038 9:137514359-137514381 ACCCGGATGTTGAGGTGCCTGGG + Intronic
1062640129 9:137514642-137514664 ACCCGGATGTTGAGGTGCCTGGG + Intronic
1062640188 9:137514838-137514860 ACCTGGATGTTGAGGTGCCTGGG + Intronic
1193572459 X:83161074-83161096 ACCTGGACCTAGGTGGGTCTGGG - Intergenic
1200126501 X:153817530-153817552 ACCTGGAGGAAGGGGGGCCTGGG + Intronic