ID: 1146843703

View in Genome Browser
Species Human (GRCh38)
Location 17:36170943-36170965
Sequence GATGAAGGAGTCGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 14, 1: 1, 2: 5, 3: 3, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146843703_1146843707 -7 Left 1146843703 17:36170943-36170965 CCTCCTGGGGCGACTCCTTCATC 0: 14
1: 1
2: 5
3: 3
4: 100
Right 1146843707 17:36170959-36170981 CTTCATCCTCCAAGTCTCCAGGG 0: 18
1: 0
2: 5
3: 29
4: 280
1146843703_1146843706 -8 Left 1146843703 17:36170943-36170965 CCTCCTGGGGCGACTCCTTCATC 0: 14
1: 1
2: 5
3: 3
4: 100
Right 1146843706 17:36170958-36170980 CCTTCATCCTCCAAGTCTCCAGG 0: 18
1: 1
2: 2
3: 36
4: 298
1146843703_1146843708 -4 Left 1146843703 17:36170943-36170965 CCTCCTGGGGCGACTCCTTCATC 0: 14
1: 1
2: 5
3: 3
4: 100
Right 1146843708 17:36170962-36170984 CATCCTCCAAGTCTCCAGGGTGG 0: 17
1: 0
2: 4
3: 22
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146843703 Original CRISPR GATGAAGGAGTCGCCCCAGG AGG (reversed) Intronic