ID: 1146846030

View in Genome Browser
Species Human (GRCh38)
Location 17:36182816-36182838
Sequence TCCCGGCTTCGGGGTGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146846020_1146846030 3 Left 1146846020 17:36182790-36182812 CCCCTCCACTGGCTCCGGCTTGA 0: 1
1: 3
2: 0
3: 5
4: 103
Right 1146846030 17:36182816-36182838 TCCCGGCTTCGGGGTGCTCTCGG 0: 1
1: 1
2: 0
3: 5
4: 116
1146846022_1146846030 1 Left 1146846022 17:36182792-36182814 CCTCCACTGGCTCCGGCTTGATG 0: 1
1: 0
2: 1
3: 6
4: 65
Right 1146846030 17:36182816-36182838 TCCCGGCTTCGGGGTGCTCTCGG 0: 1
1: 1
2: 0
3: 5
4: 116
1146846024_1146846030 -2 Left 1146846024 17:36182795-36182817 CCACTGGCTCCGGCTTGATGGTC 0: 1
1: 0
2: 3
3: 14
4: 70
Right 1146846030 17:36182816-36182838 TCCCGGCTTCGGGGTGCTCTCGG 0: 1
1: 1
2: 0
3: 5
4: 116
1146846017_1146846030 14 Left 1146846017 17:36182779-36182801 CCGACTTCGCGCCCCTCCACTGG 0: 1
1: 0
2: 2
3: 9
4: 134
Right 1146846030 17:36182816-36182838 TCCCGGCTTCGGGGTGCTCTCGG 0: 1
1: 1
2: 0
3: 5
4: 116
1146846021_1146846030 2 Left 1146846021 17:36182791-36182813 CCCTCCACTGGCTCCGGCTTGAT 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1146846030 17:36182816-36182838 TCCCGGCTTCGGGGTGCTCTCGG 0: 1
1: 1
2: 0
3: 5
4: 116
1146846016_1146846030 22 Left 1146846016 17:36182771-36182793 CCAACTCGCCGACTTCGCGCCCC 0: 1
1: 1
2: 3
3: 1
4: 46
Right 1146846030 17:36182816-36182838 TCCCGGCTTCGGGGTGCTCTCGG 0: 1
1: 1
2: 0
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146846030 Original CRISPR TCCCGGCTTCGGGGTGCTCT CGG Intronic