ID: 1146848013

View in Genome Browser
Species Human (GRCh38)
Location 17:36196860-36196882
Sequence TGCTGAGTGTTGCACAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146848013 Original CRISPR TGCTGAGTGTTGCACAACTC AGG Intronic
900876356 1:5345474-5345496 TGCTGACTGATGCCCAACACTGG + Intergenic
900995150 1:6118645-6118667 TGGTGATGGTTGCACAACTCTGG + Intronic
901855321 1:12040902-12040924 AGCTGTGTGTTGCAGAACACTGG + Intergenic
902122251 1:14176307-14176329 TGCTTAGTGTTGAGCAACTGGGG - Intergenic
902871954 1:19319198-19319220 TGGTGACAGTTACACAACTCTGG - Intronic
903107884 1:21100281-21100303 TGGTGATGGATGCACAACTCTGG + Intronic
905213004 1:36387074-36387096 TGCAGAGTGTGGCACAACGGTGG - Intergenic
908344345 1:63216405-63216427 TGGTGAAGGTTGCATAACTCTGG + Intergenic
908472088 1:64454099-64454121 TGCTCAGAGTAGCACAACTCAGG - Intergenic
909866637 1:80681548-80681570 TGATGAGTGTTACACACTTCAGG - Intergenic
910817146 1:91303083-91303105 TGATGACTGTTGCACAACCTTGG - Intronic
911044338 1:93616507-93616529 TGCTGAGTGGTACACAGGTCTGG - Intronic
918693004 1:187505997-187506019 TGGTGATAGTTGTACAACTCTGG + Intergenic
918825748 1:189321710-189321732 TGCTGAGTGTTCTTCAACTATGG - Intergenic
920589370 1:207202255-207202277 TGCTGACTGTAGCACACCACTGG + Intergenic
920729155 1:208466571-208466593 TGCTGCGCATTGCACACCTCTGG - Intergenic
920797096 1:209149730-209149752 TGGTTAGCGTTGTACAACTCTGG + Intergenic
923539290 1:234876543-234876565 TGCTGAGCGTTGCACAATCAGGG + Intergenic
924634456 1:245772521-245772543 TGCTTGGTGTTGCACAGCTGTGG + Intronic
1064036598 10:11918556-11918578 TGCTTGGTTTTGCACACCTCAGG + Intergenic
1064735160 10:18374670-18374692 TGCAGAGTGTTGAACTACTGTGG - Intronic
1065250906 10:23812594-23812616 TGGTGATGGTTGCACAACTCTGG - Intronic
1066401034 10:35076326-35076348 TCATGATAGTTGCACAACTCTGG + Intronic
1068107735 10:52640204-52640226 TGGTGAGGCTTGCACAAGTCAGG - Intergenic
1068302529 10:55162844-55162866 TGCTTAGTATTACACAACTTAGG + Intronic
1071151596 10:82641640-82641662 GGCTGAATGTTGGACAATTCAGG + Intronic
1072496422 10:95964860-95964882 CGGTGATTGTTGCACAATTCTGG - Intronic
1075220881 10:120583511-120583533 TGGTAATGGTTGCACAACTCTGG - Intronic
1080683843 11:34499379-34499401 TGCATGGTGTTGCACAACTGCGG - Intronic
1080811727 11:35711116-35711138 TAATGATAGTTGCACAACTCTGG + Intronic
1080869852 11:36227669-36227691 TGGTGATAGTTGCACAAATCAGG + Intronic
1081422294 11:42883206-42883228 TACTGAGTGTTGCCTAATTCTGG + Intergenic
1081884163 11:46480502-46480524 GGATGAGGGTTGCACAACCCTGG - Intronic
1082263175 11:50093137-50093159 TGGTGATTGATGCACAGCTCTGG + Intergenic
1083477191 11:62922214-62922236 GGCTGAGTGTTGCCCAACTGTGG + Intergenic
1084869373 11:72086808-72086830 TGTTCAGTGGTGCATAACTCTGG + Intronic
1086170020 11:83825794-83825816 TCCTGAGTGACCCACAACTCTGG + Intronic
1087133784 11:94694093-94694115 TGATGATTGTTGCACAAGTGTGG - Intergenic
1090648566 11:128786720-128786742 TGCTGATTGTTGCACACTGCTGG - Intronic
1103464835 12:121133639-121133661 TGGGGATGGTTGCACAACTCTGG - Intronic
1103466220 12:121143952-121143974 TGATGATGGTTGCACAACTTGGG - Intronic
1103917165 12:124381894-124381916 TGCCAAGTGTTACATAACTCCGG + Intronic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1108583177 13:51845037-51845059 TGCTGAGTGCTGCCCGATTCTGG - Intergenic
1111293870 13:86255477-86255499 GGCTGTGCGCTGCACAACTCGGG - Intergenic
1112614608 13:100990507-100990529 TGCTGAGCTTTGGACAACACAGG + Intergenic
1119542141 14:75446733-75446755 TAGTGATAGTTGCACAACTCTGG + Intronic
1121252733 14:92511909-92511931 TAGTGATGGTTGCACAACTCTGG - Intergenic
1123505054 15:20933622-20933644 TGGTAATGGTTGCACAACTCTGG + Intergenic
1123598544 15:21944604-21944626 TGGTAATGGTTGCACAACTCTGG + Intergenic
1125608682 15:40956721-40956743 AGCTGAATTCTGCACAACTCAGG - Intergenic
1125747528 15:42007173-42007195 TGCTGAGGCTGTCACAACTCAGG + Intronic
1125997847 15:44181568-44181590 TGGTGAGGGTTGCACAACTCTGG - Intronic
1127854069 15:62940522-62940544 TGCAGGGGGTTGCACAACCCTGG + Intergenic
1129973190 15:79798493-79798515 TGGTGATAGTTGCACAACTCTGG - Intergenic
1202970644 15_KI270727v1_random:234458-234480 TGGTAATGGTTGCACAACTCTGG + Intergenic
1133863762 16:9621853-9621875 TGCTGAGGGGTGCTCAACTCAGG - Intergenic
1135124875 16:19800256-19800278 GGCTGTGCGCTGCACAACTCGGG + Intronic
1136409318 16:30066997-30067019 TGCTGGGTGTTGCCCAGCTGAGG - Exonic
1136487607 16:30583314-30583336 TGCCTAGGGTTGCAGAACTCTGG + Exonic
1141701576 16:85644723-85644745 TGGTGATGGTCGCACAACTCTGG + Intronic
1145724693 17:27107799-27107821 TGCTTAGTATTACACAACTTAGG - Intergenic
1146848013 17:36196860-36196882 TGCTGAGTGTTGCACAACTCAGG + Intronic
1148609032 17:48951678-48951700 TGCTGAGTGTAGCCACACTCAGG + Intergenic
1150167287 17:62956137-62956159 AGTTGAGTGTTGCCTAACTCAGG + Intergenic
1152515086 17:80818455-80818477 TGCTGAGTCTTGCCCAACTCGGG - Intronic
1157594594 18:48856828-48856850 TGGTGATGGTTGCACAATTCTGG + Intronic
1158112899 18:53961564-53961586 TGCTGAGAGGTGCACAAGCCTGG - Intergenic
1162043078 19:7982069-7982091 TGCTGAGTGTTTCACAAAGGGGG - Intronic
1162498853 19:11039580-11039602 CGCTGAGGGCTGCACAACACTGG + Intronic
1164942464 19:32261759-32261781 TGCTGAGTGTTTCATCATTCAGG - Intergenic
1166033467 19:40150298-40150320 TGGTAATGGTTGCACAACTCTGG + Intergenic
925096146 2:1205405-1205427 TTGTGAGTGTTGCAGATCTCAGG + Intronic
926447044 2:12955903-12955925 TGCAGAGTGTAGCAGAACACCGG - Intergenic
930990165 2:57644822-57644844 TGGTGATGGTTGCACAATTCTGG - Intergenic
932099757 2:68887723-68887745 TGATGATGGTTGCACAACCCTGG + Intergenic
935879631 2:107550970-107550992 TGCTGACTGTAGCACACCACTGG + Intergenic
936521955 2:113217146-113217168 TGCTCAGTGTTGAAGAACTTGGG + Exonic
940081712 2:149810824-149810846 TTATGAGTGTAGCACAAATCAGG - Intergenic
946466324 2:219915044-219915066 TGCTGGCTGTTGCTCAGCTCTGG + Intergenic
1170711745 20:18797655-18797677 TGCTGGGGTTTTCACAACTCAGG - Intergenic
1172311759 20:33923808-33923830 AGCTGACTCTTGCACAACACAGG + Intergenic
1175334888 20:58189072-58189094 TGCTGTGTGTCCCACAACTTGGG + Intergenic
1175379255 20:58551565-58551587 TGGTGACAGTTACACAACTCTGG - Intergenic
1175528528 20:59655356-59655378 TGATGATAGTTGCACAACTCTGG - Intronic
1177041772 21:16121406-16121428 TGCTGTGAATGGCACAACTCAGG + Intergenic
1182559074 22:31145061-31145083 TGGTGACGGTTGCACAACTATGG - Intergenic
1184594489 22:45505496-45505518 TGCTGAGTGCCCCCCAACTCAGG + Intronic
949830369 3:8208083-8208105 AGCTGAGTGTGGAACATCTCAGG - Intergenic
950320670 3:12049890-12049912 TGCTTTGTGTTGCACAGTTCTGG - Intronic
950936669 3:16846294-16846316 TGCTCAGTGTTGCAGAAGGCAGG + Intronic
952547608 3:34437394-34437416 TGCAAAGTCTTTCACAACTCAGG + Intergenic
953119375 3:40024933-40024955 TGGTGCCTGCTGCACAACTCTGG + Intronic
953841625 3:46394382-46394404 TCCTGAATGTTCCACAAGTCTGG - Intergenic
957692563 3:83590851-83590873 TGCTGAGTTTACCAGAACTCAGG - Intergenic
960166133 3:114403620-114403642 TCCTGAGTGTTGTACAAATATGG - Intronic
960327278 3:116313212-116313234 TGCCGAGTGTTGCAGAGCTGTGG - Intronic
960949757 3:122991749-122991771 GGTTGTGTGTGGCACAACTCTGG - Intronic
961308149 3:125974116-125974138 TGCTGAGTGTTACTCTACCCGGG + Intronic
962469207 3:135690266-135690288 TTCTGAGTGAGGCCCAACTCAGG - Intergenic
964504752 3:157386959-157386981 TGCTGAGTATTGATGAACTCAGG + Intronic
965229161 3:166028861-166028883 TGCTGAGGGCTGCACTTCTCAGG - Intergenic
968791791 4:2669910-2669932 TACTGAGAGCTGCAGAACTCTGG - Intronic
970010331 4:11451777-11451799 TGCTGAGTGTTGTTCAGCTTTGG + Intergenic
974870954 4:67640927-67640949 TACTGCCTGTTTCACAACTCAGG + Intronic
977875021 4:102139511-102139533 TGCTGTGGGTTGCACCACTCTGG + Intergenic
979507817 4:121518158-121518180 TGATGATGGTTGCACAACTGTGG - Intergenic
983203765 4:164890312-164890334 TGGTGATGGTTGCACAACTTAGG - Intronic
985106905 4:186509090-186509112 AGCTGAGTCTTGAACAACTCAGG - Intronic
987733713 5:21810383-21810405 TGCTGATTTTTCCAGAACTCAGG - Intronic
988407861 5:30847489-30847511 TTCTGAGTTTTGTCCAACTCTGG - Intergenic
988781242 5:34523940-34523962 TGCTGAGTGTTCCCCATCTTAGG - Intergenic
991344658 5:65650819-65650841 TGCTGTGAGTTATACAACTCAGG + Exonic
992666734 5:79017718-79017740 AGCTGACTGTTGAACAACTCAGG + Intronic
992838028 5:80659313-80659335 TGATGATGGTTGCACAACTCTGG - Intronic
992883636 5:81135356-81135378 TTGTGACTGTTGCCCAACTCTGG - Intronic
994264312 5:97696818-97696840 TGCTGAGTGTTGCATAATAGTGG + Intergenic
995862194 5:116652555-116652577 TTCTGAGTGTTGCTGAACTGAGG + Intergenic
996243425 5:121229809-121229831 TGCTGAGTGTTGGCAAACACGGG + Intergenic
997529652 5:134573943-134573965 TGCCTAGTGACGCACAACTCAGG - Intronic
997823495 5:137086399-137086421 TGCTGAGTGCTGCTCAGCCCTGG - Intronic
1002850982 6:996105-996127 TGGGGAAGGTTGCACAACTCTGG + Intergenic
1004361832 6:14978124-14978146 TGGTGATAGTTGCACAACTTTGG - Intergenic
1006153774 6:32003165-32003187 ACCTGAGGATTGCACAACTCCGG - Intergenic
1006160082 6:32035902-32035924 ACCTGAGGATTGCACAACTCCGG - Intergenic
1006593400 6:35174773-35174795 TGGTGATAGTTGCACAACTTTGG + Intergenic
1008810439 6:55491078-55491100 ATCTCAGTTTTGCACAACTCAGG + Intronic
1012812881 6:103983382-103983404 TGCTGAGTCTACCAGAACTCAGG + Intergenic
1015837083 6:137432112-137432134 TGCTGTGATTTGCACAACCCAGG + Intergenic
1017572575 6:155762924-155762946 TGCCAGGTGTTGCATAACTCTGG - Intergenic
1019309534 7:353383-353405 TGGTGAGTGGTGCCCCACTCAGG - Intergenic
1024227307 7:47335718-47335740 TGCTGAGTGTTGATCAGGTCTGG + Intronic
1026432599 7:70362087-70362109 TGCTGATTTATGCAGAACTCGGG + Intronic
1027149330 7:75721618-75721640 GGCTGAGCGTTGCACAACTTTGG - Intronic
1027797976 7:82717782-82717804 GGCTTAGTGGTGCACAACCCTGG + Intergenic
1029311664 7:99672784-99672806 TGCTGTGTGTCGTACAACTAGGG - Intronic
1029371907 7:100155622-100155644 TGCTGAGTGATGCAGAATGCTGG - Intronic
1032193608 7:129777999-129778021 AGGTGAGTGTTGCAGGACTCTGG + Intergenic
1037384810 8:18326936-18326958 TCTTGAATGTTTCACAACTCAGG + Intergenic
1039121760 8:34155962-34155984 TGGTTAGTGTTGTACAACACTGG + Intergenic
1043291824 8:78611651-78611673 TTCTCAGTGATGCTCAACTCTGG + Intergenic
1043723866 8:83583917-83583939 TACTAAGTTTTGCAAAACTCAGG + Intergenic
1047393248 8:124471604-124471626 ATTTGAATGTTGCACAACTCAGG - Intergenic
1048302452 8:133261429-133261451 TGCTGAAGGTTGCACAGCTGAGG - Intronic
1049431090 8:142565350-142565372 TGCTGTGTGGTGCCCATCTCAGG + Intergenic
1051372986 9:16374098-16374120 TGCTGAGTGCTGGACCAGTCAGG + Intergenic
1054957750 9:70932839-70932861 TGCTGAGTGTAGAACATCTTAGG + Intronic
1057030102 9:91768954-91768976 TTGTGAGCGTTGCACCACTCTGG - Intronic
1058191845 9:101926722-101926744 TGGTGATGCTTGCACAACTCTGG - Intergenic
1058967037 9:110048417-110048439 AGCTGAGTGTTTCCTAACTCAGG - Intronic
1059129286 9:111728741-111728763 TGGTGATGATTGCACAACTCTGG + Intronic
1060229439 9:121815690-121815712 AGCTGAGTGTTGCTAAACACAGG - Intergenic
1203701321 Un_GL000214v1:136028-136050 TGCTGACTGTGGCAGAAATCTGG + Intergenic
1186923959 X:14311693-14311715 TGTTGACAGTTGGACAACTCTGG + Intergenic
1190621219 X:52288504-52288526 TGCTGAGGGTTGCACTCATCAGG + Intergenic
1191022513 X:55877815-55877837 TGCTGTGGCTTGCACAACACTGG + Intergenic
1191085710 X:56564851-56564873 TGCTGGTAGTTGCAGAACTCTGG - Exonic
1193408520 X:81134489-81134511 TGGTGATGGTTGCACAATTCTGG - Intronic
1194554812 X:95343033-95343055 TGGTGATTGTTGCACAACAATGG + Intergenic
1195431534 X:104794989-104795011 TGCTGAGTGTGGAATAGCTCTGG + Intronic
1195982629 X:110595938-110595960 TGGTGAGTATTACAAAACTCAGG - Intergenic
1198886145 X:141339978-141340000 TGGTGATTGCTGTACAACTCTGG + Intergenic
1201619272 Y:15937482-15937504 TGCGGACTGTTTTACAACTCAGG + Intergenic
1201731093 Y:17204052-17204074 AGGTGATTGTTGCACAACACTGG + Intergenic