ID: 1146849087

View in Genome Browser
Species Human (GRCh38)
Location 17:36206356-36206378
Sequence GGTTGCAAGAAGTGACAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146849087 Original CRISPR GGTTGCAAGAAGTGACAGCA AGG (reversed) Intronic
902410328 1:16208234-16208256 GGGGGCAAGGAGTGAGAGCACGG + Intronic
903724767 1:25431705-25431727 AGGTGAAAGAAGTGACAGCATGG - Intronic
903944123 1:26951198-26951220 GGATGCAAGAGTTGACAGAAAGG + Intronic
904843382 1:33389112-33389134 AGTTGGAAGAAGTGACAACCAGG + Intronic
905223904 1:36467120-36467142 TGTTGCCGGAAGTGACAGGAAGG + Intronic
905518925 1:38582549-38582571 GGCTGGAAGAAGTAGCAGCAAGG - Intergenic
907558727 1:55368472-55368494 GGTTGCAAGAAGTGAAAATATGG + Intergenic
911346716 1:96705627-96705649 GGTTGCCAGTAGGTACAGCAGGG - Intergenic
915285820 1:154851387-154851409 GGTTGTAAGAGGTCACAGGATGG - Intronic
916715904 1:167446566-167446588 AGGTACAAGGAGTGACAGCAGGG + Intronic
916881472 1:169023361-169023383 GGATGCAAAAAGAGATAGCAGGG - Intergenic
919167743 1:193917425-193917447 GCTTGCAAGAGATGTCAGCAAGG - Intergenic
922322504 1:224500971-224500993 GGTTCCAGGAAGTGGCAGAAGGG - Intronic
923155688 1:231277306-231277328 TGCTCCAAGAGGTGACAGCATGG - Intronic
1062867341 10:866849-866871 CTTTGAAAGCAGTGACAGCATGG + Intronic
1063496875 10:6518032-6518054 GGTTGCCAGGAGTTGCAGCAGGG + Intronic
1066064145 10:31750209-31750231 GGATGCAAGAAGAGACAGAGCGG + Intergenic
1069688241 10:70333162-70333184 GGTTGCAAGAAGTGTTAGCTTGG + Intronic
1070602809 10:77877669-77877691 TCTGGCCAGAAGTGACAGCAGGG - Intronic
1070943170 10:80365064-80365086 GGTTGCATGAAATTTCAGCAGGG + Intronic
1071494852 10:86161222-86161244 GGTAGCAAGGAGTGTCAGGAGGG + Intronic
1076003732 10:126931738-126931760 GGTTCCTGGAAGTGACAGGAAGG - Intronic
1077009952 11:375294-375316 CGTTCCAAGAAGGGGCAGCAGGG - Intronic
1089444420 11:118540440-118540462 AGTCAAAAGAAGTGACAGCAAGG - Intronic
1089706851 11:120284315-120284337 GGATGCAAGAAAAGACAACAGGG - Intronic
1090080231 11:123607563-123607585 GGTTGGCACAAGTGACTGCATGG + Intronic
1091046711 11:132331931-132331953 TGTGGCAAGAAGAGACACCAAGG + Intronic
1093050178 12:14495318-14495340 TTTTGCAAAATGTGACAGCAAGG + Intronic
1095750540 12:45705658-45705680 GATTGCAAGAGATGGCAGCATGG - Intergenic
1096255385 12:50059027-50059049 GGTTGCACAGCGTGACAGCAGGG - Exonic
1096809082 12:54158369-54158391 GGTTTCAAGAAGGGAAAGTAGGG - Intergenic
1097934319 12:65228117-65228139 GGTTGGAAGAAGTGAAAGAGAGG - Intronic
1100771548 12:97928345-97928367 GGTTGCAATGAGTGAGAGGAAGG + Intergenic
1103082333 12:118035151-118035173 GCTTGCAAGTAATGGCAGCAAGG - Intronic
1103997827 12:124841613-124841635 GGTTGGGAGAAGTGACTGGAGGG - Intronic
1106604409 13:31214152-31214174 GGGTGGGAGAAGTGACACCATGG - Intronic
1108415885 13:50197883-50197905 GGATGCCAGCAGTGACATCACGG + Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109404111 13:61875280-61875302 AGTGGCATGAAGTGAAAGCAAGG + Intergenic
1115495569 14:34000993-34001015 GGCTGCAAGGGGAGACAGCATGG + Intronic
1116289265 14:43011305-43011327 CCTTACAAGAAGAGACAGCAGGG - Intergenic
1116408404 14:44594253-44594275 GGTGGCAAGAAGTGACATAGGGG + Intergenic
1118539298 14:66804831-66804853 GGATGCAAAATGTCACAGCAGGG - Intronic
1118669803 14:68111729-68111751 GGTTGCCAGAAGTGCCACCTGGG + Intronic
1121570229 14:94941636-94941658 GCCTGCAAGCAGGGACAGCAGGG + Intergenic
1130303698 15:82699230-82699252 GGTGGTAAGAGGTGACAGCGAGG - Intronic
1130827833 15:87567628-87567650 AGTTGCAAGAAGTCACCCCAGGG + Intergenic
1136016960 16:27406464-27406486 GGCTGGAAGAAGTGCCAGGAGGG + Intronic
1137685815 16:50386104-50386126 GGTGGAAAGAGGTGACAGAAGGG - Intergenic
1138144375 16:54595580-54595602 GGCAGTGAGAAGTGACAGCAAGG + Intergenic
1141951073 16:87339721-87339743 AATTGCAAGAAGAGACAGCAAGG + Intronic
1143406697 17:6682483-6682505 GGCTCCAAGATGAGACAGCATGG + Intergenic
1145971756 17:28960390-28960412 ACTTGGAAGGAGTGACAGCATGG + Intronic
1146472912 17:33138934-33138956 GGTTGGAAGTAGTGCCAGCCTGG + Intronic
1146834476 17:36099170-36099192 GGTTGCAAGAAGTGACAGCAAGG - Intergenic
1146849087 17:36206356-36206378 GGTTGCAAGAAGTGACAGCAAGG - Intronic
1149373276 17:56018122-56018144 GGGTCACAGAAGTGACAGCATGG + Intergenic
1149757478 17:59199520-59199542 GTTTGGAAGAAGTCACACCAGGG - Intronic
1152181504 17:78824811-78824833 GGGTTCAGAAAGTGACAGCAAGG + Intronic
1152445772 17:80342163-80342185 GGCTGCAAGCCGTGACAGCATGG - Intronic
1154232650 18:12571560-12571582 GGTTGCAATCAGTGTCAGCATGG - Intronic
1157143021 18:45130683-45130705 GAAAGCTAGAAGTGACAGCATGG - Intergenic
1157793482 18:50554665-50554687 GGTTGAAAGAAGAGACTGCTGGG + Intergenic
1157945398 18:51973842-51973864 GGTTGTCAGAAGTGTGAGCAGGG + Intergenic
1158895239 18:61906616-61906638 GCTTGAAAGAATTGAAAGCAGGG - Intergenic
1159156603 18:64591280-64591302 AGCTGCCAGAGGTGACAGCAAGG + Intergenic
1161262169 19:3344100-3344122 GGTTCCAGGAACTGCCAGCAGGG + Intergenic
1164141015 19:22463030-22463052 GTTTGCAAGTACTGAAAGCACGG - Intronic
1165281512 19:34802266-34802288 GTTTTCAAAAAGTCACAGCATGG + Intergenic
1167015773 19:46839976-46839998 GGTAGCAGGAAGTCACAGAAGGG - Intronic
925388853 2:3482285-3482307 GGGTGCAAGACGTGACAAGATGG - Intronic
928241617 2:29591655-29591677 GGAGGCAAGGAGTGACAGCAGGG + Intronic
929312101 2:40437275-40437297 GGTGGGAAGAAGGGGCAGCATGG - Intronic
930033656 2:47072719-47072741 GGTGGCATGAGATGACAGCACGG - Intronic
930901794 2:56516120-56516142 GGTTTAAAAAAGTGAGAGCAGGG - Intergenic
933862999 2:86488715-86488737 GGTTGCCCAAAGTGACTGCAGGG + Intronic
935688900 2:105712598-105712620 CGCTGCAGGAAGTGACAGCTGGG - Intergenic
940327242 2:152438316-152438338 GGTAGCTAGAAGTAAAAGCATGG + Intronic
940997529 2:160165829-160165851 GGATGGAAGAAGGGACAGCCAGG + Intronic
941216558 2:162717064-162717086 GGTTGAAAGAAATAACTGCATGG + Intronic
941884458 2:170514003-170514025 AGGTGCAAGAAGTGAGAACAAGG + Intronic
944013427 2:195002374-195002396 AATTGCAAGAAATGACAGGAAGG + Intergenic
945111228 2:206361783-206361805 TGTTGCAATAAATGTCAGCATGG + Intergenic
946579295 2:221109262-221109284 GGTAGCTAGAGGTGACAGCATGG + Intergenic
946906421 2:224421061-224421083 GGTTGGCAGGAGTCACAGCAGGG + Intergenic
947133093 2:226949836-226949858 GGATGCAAAAAGAGACACCAAGG - Intronic
1173905890 20:46628448-46628470 GGTTGAAGGAACTGACGGCAAGG + Intronic
1174646321 20:52089000-52089022 GTTTGGAAGAAGTGAGAGGAAGG - Intronic
1174981341 20:55398838-55398860 GGATGCAAGCAGTGACACAATGG + Intergenic
1175642682 20:60643939-60643961 GGTACCAAGAAATGATAGCAAGG - Intergenic
1179511319 21:41875735-41875757 TGTTGCAAAAAGTTACAGTAGGG - Intronic
1180705369 22:17806578-17806600 AGTTGCTATAAGTGACAACATGG - Intronic
1181266065 22:21631725-21631747 TTTTGGAAGAAGTGACACCATGG + Intergenic
1182149465 22:28018064-28018086 GGTTGCAAGAAGGGCCAGGGTGG - Intronic
1184118001 22:42433100-42433122 TGCTGCTAGAAGTGAGAGCAGGG - Intergenic
1184176818 22:42793578-42793600 GGTTGCAAGGGGTTCCAGCAGGG + Intergenic
1184852954 22:47131282-47131304 GGATGCACGAGGTTACAGCAAGG - Intronic
952414747 3:33080726-33080748 GGTGGAAAGAAGGGACAGCCTGG - Intronic
954270477 3:49504153-49504175 GGGTGCCAGAAGTTACAGAAGGG - Intronic
960096306 3:113693558-113693580 GGTTGCAGGAAGAGTCAGAAGGG + Intronic
961627519 3:128274160-128274182 GTTACAAAGAAGTGACAGCAGGG + Intronic
961707070 3:128795493-128795515 GAAAGCAAGAAGTGGCAGCACGG - Intronic
966740735 3:183231215-183231237 GGTATCAAGAAGAAACAGCAAGG + Intronic
970441544 4:16084164-16084186 CGTTGCAAGAAGGGAGTGCAGGG - Intronic
970458647 4:16250971-16250993 GGTTACAAAAAGTGAAAACAAGG - Intergenic
971242719 4:24903086-24903108 GGTTGCAGGAAATGGAAGCAAGG - Intronic
972474350 4:39436309-39436331 AGTTGCAGGAAGGAACAGCATGG + Intronic
975372003 4:73599890-73599912 GGTTGCATGAAGTGAGGGAAGGG - Intronic
981073022 4:140565072-140565094 GATTCCAGGAAGTCACAGCAGGG - Intronic
981896546 4:149808389-149808411 GGTTACTAGAAGAGACAGAAGGG + Intergenic
982641685 4:157969511-157969533 GGTTGAAAAAAGTGACCTCAAGG - Intergenic
983115185 4:163806558-163806580 GGTTGTAAGTTGTCACAGCATGG - Intronic
983205052 4:164902840-164902862 GTCTGCAGGAGGTGACAGCAGGG + Intergenic
984715413 4:182919832-182919854 GGTTGTAAGAAGTGGGAGTAGGG - Intergenic
985562502 5:596640-596662 GGTTGCAAGAAGTCATATGAGGG - Intergenic
990391518 5:55326493-55326515 AGTGGGAAGAAGTGACAGAAAGG - Intronic
1000213885 5:159136563-159136585 GCTTCCTAGAAGAGACAGCAAGG - Intergenic
1000923955 5:167171289-167171311 GGTTCTAGGAAGTGACAGAAGGG - Intergenic
1002589933 5:180283527-180283549 GGTTGAAAGCAGTTATAGCAGGG - Intronic
1006133970 6:31884596-31884618 GGCTGCAAGAAGTGGGGGCAGGG + Intronic
1011113108 6:83859970-83859992 GGTTGCAGGCAAGGACAGCAGGG - Intronic
1015566295 6:134574772-134574794 TTTTGCAAGAAATGAGAGCATGG - Intergenic
1016733782 6:147453957-147453979 GGCTGCAACAATTGGCAGCAAGG - Intergenic
1017168470 6:151432780-151432802 AATGGCAAGAAGAGACAGCAGGG + Intronic
1017566465 6:155692491-155692513 GGATCCTGGAAGTGACAGCAGGG + Intergenic
1017973924 6:159337928-159337950 GGTTCTAAGCAGTTACAGCAAGG + Intergenic
1019023731 6:168940909-168940931 GGGTGGAGGAAGGGACAGCAAGG + Intergenic
1019448808 7:1085446-1085468 GGTTGCAGAAACTGACTGCAGGG - Intronic
1022514159 7:30964845-30964867 GGTTACTGCAAGTGACAGCAGGG + Intronic
1023342465 7:39235816-39235838 GTTTGCATCAAGTGACACCAAGG - Intronic
1023595392 7:41823935-41823957 AGTTGCAAGAAGTGCCAGTGAGG - Intergenic
1023765068 7:43503107-43503129 GTTTGGAGGAAGTGACAACAGGG - Intronic
1024527012 7:50357442-50357464 GGTTGTGAGAAGTCACAGAAGGG - Intronic
1029243535 7:99181888-99181910 GGATGCAAGAGATGACATCAAGG + Exonic
1034218797 7:149428744-149428766 GGTGGCAAGAAGTCAGAACAAGG + Intergenic
1036026687 8:4916849-4916871 TTTTGCAAGAAATGACAGAAAGG + Intronic
1036056286 8:5258514-5258536 GGAAGCAGGAAGTGAGAGCAAGG + Intergenic
1037418417 8:18676173-18676195 GCTTGCCAGGAATGACAGCATGG + Intronic
1040049237 8:42995994-42996016 GATTGCAAGAAGGGAAAACATGG - Intronic
1044048976 8:87475706-87475728 CTTTTCAAGAAGAGACAGCATGG + Intronic
1044821605 8:96159390-96159412 GGTGGCAAGAAGGGGCCGCAAGG + Intronic
1045784531 8:105904842-105904864 AGAAGCAAGAAATGACAGCAAGG - Intergenic
1047764338 8:127978076-127978098 GCTTGAAAGAAGTGACAGTGTGG - Intergenic
1055261935 9:74447203-74447225 GGTAGGAAGAAGTTACAGGAAGG + Intergenic
1055631369 9:78227390-78227412 TGTTGATATAAGTGACAGCATGG - Intergenic
1059854596 9:118382717-118382739 GGAGGGAAGAAATGACAGCAGGG + Intergenic
1060298321 9:122358114-122358136 GGTGGCATGAAGTTCCAGCAAGG + Intergenic
1061962509 9:133995249-133995271 GGGAGCAAGAAGTGCCAGCATGG + Intergenic
1187359732 X:18614135-18614157 TGTTGCCAGAAGTAACAGAAGGG + Intronic
1193747363 X:85298429-85298451 GGGTGAGTGAAGTGACAGCAGGG - Intronic
1198714094 X:139537857-139537879 GTGTGCAAGAAGTGACAGGAAGG - Intronic
1199698943 X:150362792-150362814 GGTGGAAAGAGGCGACAGCAGGG - Intronic
1199848249 X:151707000-151707022 GGCTACAAGGAGTGACAGGATGG + Intergenic