ID: 1146849753

View in Genome Browser
Species Human (GRCh38)
Location 17:36211952-36211974
Sequence CATCACCCCCTCCCCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 2, 2: 4, 3: 42, 4: 445}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146849753_1146849757 -10 Left 1146849753 17:36211952-36211974 CCTGTTTTGGGGAGGGGGTGATG 0: 1
1: 2
2: 4
3: 42
4: 445
Right 1146849757 17:36211965-36211987 GGGGGTGATGAGCGTTGGGGAGG 0: 1
1: 0
2: 2
3: 91
4: 579
1146849753_1146849759 2 Left 1146849753 17:36211952-36211974 CCTGTTTTGGGGAGGGGGTGATG 0: 1
1: 2
2: 4
3: 42
4: 445
Right 1146849759 17:36211977-36211999 CGTTGGGGAGGCAGCTCTCAGGG 0: 1
1: 0
2: 1
3: 12
4: 142
1146849753_1146849758 1 Left 1146849753 17:36211952-36211974 CCTGTTTTGGGGAGGGGGTGATG 0: 1
1: 2
2: 4
3: 42
4: 445
Right 1146849758 17:36211976-36211998 GCGTTGGGGAGGCAGCTCTCAGG 0: 1
1: 0
2: 1
3: 17
4: 219
1146849753_1146849760 29 Left 1146849753 17:36211952-36211974 CCTGTTTTGGGGAGGGGGTGATG 0: 1
1: 2
2: 4
3: 42
4: 445
Right 1146849760 17:36212004-36212026 AGCCTTCCCTGACAGCAGTGAGG 0: 2
1: 1
2: 3
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146849753 Original CRISPR CATCACCCCCTCCCCAAAAC AGG (reversed) Intronic
900997437 1:6130096-6130118 CATCACCCCCTCACCTATCCTGG - Intronic
901242534 1:7703988-7704010 CCGCACCCCCTCCCCAAAGCCGG + Intronic
904441459 1:30534606-30534628 CAAGACCCTCTCCCCAGAACAGG + Intergenic
904541714 1:31238298-31238320 CATCACGCCCTCCCCACCACAGG - Intronic
904752014 1:32746856-32746878 CATACCCCTTTCCCCAAAACTGG - Intronic
904957397 1:34296422-34296444 CAACACACCCTCCCCCAAGCAGG + Intergenic
905309073 1:37037064-37037086 CATCCCACCCTCCCCTAGACCGG - Intergenic
905685253 1:39902692-39902714 CTGCACCGCCTCCCCAAAGCGGG - Intergenic
906014562 1:42563449-42563471 CCTCACCCCCTACCCCCAACAGG - Intronic
906138925 1:43521754-43521776 TCTCACCCCCTCACCAAAAATGG - Intergenic
906155825 1:43613385-43613407 CAGCACCCCGCCACCAAAACAGG + Intronic
906727633 1:48055450-48055472 CATCACCCCCTGCCTGAAATTGG - Intergenic
906894987 1:49761013-49761035 CATTACCCCCACCCCCCAACAGG - Intronic
907097981 1:51799345-51799367 CAGCACCCCCACCCCCCAACAGG + Intronic
908095957 1:60738869-60738891 CCTCCCCCCCACCCCACAACAGG - Intergenic
908096395 1:60743309-60743331 CCTCCCCCCCACCCCACAACAGG - Intergenic
908567423 1:65371638-65371660 CATCATCCCTTGCCCAAGACAGG - Intronic
908764997 1:67546579-67546601 CACCACCCCCTCCATAAAAATGG - Intergenic
909723913 1:78810988-78811010 CCCCACCCCCACCCCACAACAGG - Intergenic
910817119 1:91302775-91302797 CCTCCCCCCCACCCCACAACAGG - Intronic
911563921 1:99440048-99440070 CAGAACCCCCTCCCCAAATGCGG - Intergenic
911810092 1:102265057-102265079 CACTACCCCCACCCCACAACAGG - Intergenic
911824022 1:102457825-102457847 CACTACCCCCACCCCACAACAGG - Intergenic
913450567 1:118989910-118989932 CTTCACCCCCGCCCCAAATTAGG + Intergenic
916684729 1:167134115-167134137 CACTACCACCTCCCCAAACCAGG + Intergenic
918392058 1:184075860-184075882 CATCTACCCCTACCCTAAACAGG - Intergenic
918922025 1:190724834-190724856 CATCACCCCTTTACCAAAAACGG - Intergenic
919727887 1:200895527-200895549 CCCCACCCCCTCCCTAACACAGG - Intronic
920432741 1:205929114-205929136 CCTCACCCCATCCCCTCAACTGG - Intronic
920790681 1:209087276-209087298 CATTTGCCCCTCCGCAAAACAGG + Intergenic
921096779 1:211893634-211893656 AATCTCCCCCTACCCCAAACTGG + Intergenic
921735877 1:218627945-218627967 CCTCACCCCCATCCCCAAACAGG + Intergenic
921775135 1:219089024-219089046 CATCACCCCTCCCCCAACCCAGG + Intergenic
922272192 1:224043956-224043978 CAGCACCCCCTCCCCACCAGCGG + Intergenic
922496935 1:226064241-226064263 GATCACCCCCTCCCCAAATCTGG - Exonic
922689445 1:227676669-227676691 CCCCTCCCCCTCCCCACAACAGG + Intronic
922797505 1:228347879-228347901 CATCACCTCCTCACAGAAACGGG - Intronic
923472995 1:234308719-234308741 CACAACCCCCACCCCAAAAAAGG + Intronic
923655347 1:235910953-235910975 CATCACCACTACCCTAAAACTGG + Intergenic
924856715 1:247881562-247881584 CATGACCCCTTCTCCAAATCAGG + Intergenic
1064300394 10:14118013-14118035 CCTCACCCCATCCTCTAAACAGG - Intronic
1065534887 10:26707126-26707148 CATGCTCCCCTCCCCAACACTGG - Intronic
1065582923 10:27189615-27189637 CCTCCCCCCCACCCCACAACAGG - Intergenic
1065606581 10:27424234-27424256 CCTCCCCCCCACCCCACAACAGG - Intergenic
1065759795 10:28971502-28971524 CCTCACCTCCTCCCCTAAAAAGG - Intergenic
1067077389 10:43196016-43196038 CCCCTCCCCCTCCCCAAAGCAGG + Exonic
1067214682 10:44292824-44292846 CCCCACCCCCTCCCCCCAACAGG + Exonic
1067809595 10:49417064-49417086 CTTAAGACCCTCCCCAAAACGGG + Intergenic
1067965712 10:50910419-50910441 CCCCGCCCCCACCCCAAAACAGG + Intergenic
1068335422 10:55628170-55628192 AATCACCCCCTACCAAAATCAGG + Intergenic
1068537391 10:58255415-58255437 TGTCACCCCCTCCCCCAAACTGG - Intronic
1072546299 10:96442178-96442200 CCTTTCCCCCTCCCCAAAGCTGG + Intronic
1073331345 10:102671871-102671893 CAGCACTCCCTGCCCAAAAAAGG - Intergenic
1073914520 10:108386766-108386788 TATCACCAGCTCCGCAAAACAGG - Intergenic
1074456943 10:113603492-113603514 CATGACCTCATCCCTAAAACAGG + Intronic
1074798407 10:116973061-116973083 CACCACCCACTCCCTAAAATGGG + Intronic
1075119646 10:119655094-119655116 CAGCTCCTCCTCCCCAAAATGGG - Intronic
1075816550 10:125269137-125269159 AATCCCCCCCACCCCAAAACTGG - Intergenic
1076550961 10:131277979-131278001 CTTCAGCCACTCCCCAAAACAGG + Intronic
1076751328 10:132544916-132544938 CACCACCCCCACCCCTAACCCGG - Intronic
1076757963 10:132584194-132584216 CATAACCCCAACACCAAAACCGG - Intronic
1077240833 11:1509635-1509657 CATCACCCCTCCCCAAAAAAAGG + Intergenic
1077348701 11:2078665-2078687 CCTCCCCCCCACCCCACAACAGG + Intergenic
1077696818 11:4400968-4400990 CCTCCCCCCCACCCCACAACAGG + Intergenic
1077712204 11:4548810-4548832 CCTCCCCCCCACCCCACAACAGG + Intergenic
1077780087 11:5318275-5318297 CCCCACCCCCACCCCACAACAGG + Intronic
1078463050 11:11530084-11530106 CATCCCCTCCTCCCCAACACAGG + Intronic
1079337299 11:19581514-19581536 CCTCTCCCCCACCCCACAACAGG + Intronic
1079857245 11:25621507-25621529 CCTAACCCCCACCCCCAAACAGG + Intergenic
1079974342 11:27073906-27073928 CCTTACCCCCACCCCACAACAGG - Intronic
1080150402 11:29045902-29045924 CACTACCCCCACCCCACAACAGG + Intergenic
1080270714 11:30448262-30448284 CATGGCTCCCTCCCCACAACAGG - Intronic
1080574953 11:33589754-33589776 CACCTCCCCCACCCCACAACAGG - Intronic
1081067643 11:38565798-38565820 CCTAACCCCCTCCCCTAGACAGG + Intergenic
1081238860 11:40679457-40679479 CAGCAGCCCCTCCCCATCACAGG + Intronic
1081265757 11:41019170-41019192 CCTCACCCCCACCCCGCAACAGG + Intronic
1082283135 11:50292172-50292194 CATCCCCCCCACCCCATGACAGG - Intergenic
1082654902 11:55842511-55842533 CCCCACCCCCACCCCACAACAGG + Intergenic
1082967481 11:58981663-58981685 CCCCACCCCCACCCCACAACAGG + Intronic
1083025060 11:59543681-59543703 CCTTCCCCCCACCCCAAAACAGG + Intergenic
1083063945 11:59903989-59904011 CCTCCCCCCTCCCCCAAAACAGG - Intergenic
1083696753 11:64448584-64448606 ATTCACCCCCTCCCCCAACCTGG - Intergenic
1085262860 11:75218301-75218323 CAACACCATCTCCCCAAACCCGG + Intergenic
1086260363 11:84932508-84932530 CCTCACCCCCACCACACAACAGG + Intronic
1087130197 11:94662684-94662706 CCTCACCCCTTCCGTAAAACGGG + Intergenic
1087406859 11:97741707-97741729 CAGCCCCCCCACCCCATAACAGG + Intergenic
1088757354 11:112896946-112896968 CCTCCCCCCCACCCCACAACAGG + Intergenic
1089335643 11:117721392-117721414 AGTCACCCCCTCCCCCAACCTGG + Intronic
1089784904 11:120900912-120900934 CTGCACCCCCTCCCCCAAAGTGG - Intronic
1089797015 11:120989053-120989075 CACCCCCCCATCCCCAAAAGCGG + Intergenic
1090121489 11:124033356-124033378 TAACCCCCCCACCCCAAAACAGG - Intergenic
1090122949 11:124052629-124052651 CCTCACCCCCACCCCGTAACAGG - Intergenic
1090429358 11:126633219-126633241 CCTCACCCCCACCCCACAACAGG - Intronic
1090561767 11:127940099-127940121 CATCTTCCCCTCCACCAAACTGG - Intergenic
1090881010 11:130831390-130831412 TGTCACCTCCTCCCCAAGACAGG - Intergenic
1091037517 11:132247004-132247026 CCTCCTCCCCTCCCCAAACCTGG + Intronic
1091248723 11:134123376-134123398 CACCCCCCCCCCCCCAAAAAAGG + Intronic
1091325022 11:134679603-134679625 CATCAACCCCACCCCAGAAAGGG - Intergenic
1091642516 12:2248284-2248306 CATCTCCTCCTCCCCTTAACTGG - Intronic
1091857366 12:3750787-3750809 CAACCCTCCCTCCCCACAACAGG + Intronic
1092282977 12:7111022-7111044 CAGCACCACCTCCCCTACACTGG + Intergenic
1093701890 12:22230840-22230862 CATTACCCCCTCCCCAATTGTGG - Intronic
1093777131 12:23089099-23089121 CCTCCCCCCCACCCCACAACAGG + Intergenic
1093914267 12:24783426-24783448 CACCACCCCCACCCCCCAACAGG - Intergenic
1094445031 12:30520305-30520327 CACTACCCCCACCCCACAACAGG + Intergenic
1096259676 12:50082859-50082881 CCTCACCCTCTCCCCCAACCCGG + Exonic
1096264013 12:50109812-50109834 CATCACCCCCGCCACCAAGCAGG - Exonic
1097305475 12:58063852-58063874 CCCCACCCCCACCCCACAACAGG - Intergenic
1097366155 12:58715715-58715737 CATGCCCCCCACCCCACAACAGG + Intronic
1097534868 12:60855928-60855950 CCTCCCCCCCACCCCACAACAGG + Intergenic
1097751176 12:63354573-63354595 CCTCCCCCCCACCCCACAACAGG - Intergenic
1100658855 12:96675931-96675953 CCTGCCCCCCACCCCAAAACAGG - Intronic
1100784589 12:98065649-98065671 CATCACCCCATTCCCAATCCAGG + Intergenic
1101960028 12:109242180-109242202 CATCACACACTCCCAACAACAGG - Intronic
1102842171 12:116136571-116136593 CATCACACCATCCACAGAACAGG + Intronic
1104494892 12:129227746-129227768 CACTACCCCCACCCCACAACAGG + Intronic
1104534546 12:129606595-129606617 CATCACTCCAACCCCAATACAGG + Intronic
1105351504 13:19620297-19620319 CACCACGCCCGGCCCAAAACTGG + Intergenic
1105809851 13:23985462-23985484 CATCACCCCATCCCCAATCCAGG + Intronic
1105929796 13:25041684-25041706 CATCACCCCAACCCCAATCCAGG - Intergenic
1106057896 13:26254904-26254926 CACCACTTCCTCCCCAAACCTGG - Intronic
1106255689 13:28020233-28020255 CATCTCCCCTTCCCCCAACCAGG + Intronic
1107775867 13:43840527-43840549 CACTACCCCCACCCCACAACAGG + Intronic
1108130764 13:47297645-47297667 CCTCGCCCCCTACCCCAAACTGG - Intergenic
1108196451 13:48000799-48000821 CATTCCCCCCTGCCCAAAAAGGG + Intronic
1108636710 13:52342574-52342596 CATCAGGCCCTCCCCGCAACAGG - Intergenic
1108651343 13:52482983-52483005 CATCAGGCCCTCCCCGCAACAGG + Intergenic
1108713406 13:53056234-53056256 CATCCCCACATCCCCCAAACTGG + Intergenic
1109049409 13:57459050-57459072 CACTACCCCCACCCCACAACAGG + Intergenic
1109609829 13:64750103-64750125 CGTGTCACCCTCCCCAAAACAGG - Intergenic
1109964818 13:69678737-69678759 CATTCCCCCCACCCCACAACAGG + Intergenic
1110065840 13:71104419-71104441 CACCACTCCCACCCCACAACAGG + Intergenic
1110499893 13:76214894-76214916 CCTCCCCCCCACCCCACAACAGG + Intergenic
1110761649 13:79237199-79237221 CCTCTCCCCCACCCCACAACAGG - Intergenic
1110789741 13:79574669-79574691 CCTCCCCCCCACCCCACAACAGG - Intergenic
1111967636 13:94877068-94877090 CCTTACCCCCACCCCACAACAGG - Intergenic
1112060482 13:95734968-95734990 CCTCCCCCCCACCCCACAACAGG + Intronic
1112699445 13:101988699-101988721 CCTCCCCCCCACCCCACAACAGG - Intronic
1113160099 13:107370291-107370313 CATCCTTCCCGCCCCAAAACAGG + Intronic
1113451518 13:110413446-110413468 CATCTTCCCCTCCTCACAACTGG - Intronic
1114225802 14:20737348-20737370 CACCACACCCAGCCCAAAACTGG + Intronic
1114516567 14:23303313-23303335 CACCACCCCCTGCCCAAACCAGG - Intronic
1115477687 14:33831757-33831779 CTTCCCCCCCACCCCACAACAGG - Intergenic
1116760213 14:49003386-49003408 CATTTCCCCCTCTCCAATACAGG - Intergenic
1116922933 14:50599895-50599917 CCTCACCTCCTCCCCACACCAGG - Intronic
1116939537 14:50777069-50777091 GATCTTCCCCTCCCCAAGACTGG - Exonic
1117647087 14:57864928-57864950 CATCGCCCTCCCACCAAAACTGG + Intronic
1118633088 14:67723935-67723957 AATGACCCACTCCCTAAAACTGG + Intronic
1118895611 14:69943068-69943090 CACCACCCCCTCCCCAAGGGAGG - Intronic
1118964168 14:70563954-70563976 CATCAGTCCCTCCCCCAAACTGG + Intergenic
1118975112 14:70669979-70670001 GATGACCACCTCACCAAAACTGG - Intronic
1119096556 14:71838245-71838267 CCTCTCCCCCACCCCACAACAGG + Intergenic
1120370508 14:83628232-83628254 CAGCACCCCCACCCCACAACAGG + Intergenic
1121081852 14:91114774-91114796 CATCACTCACTCTTCAAAACAGG - Intronic
1121908889 14:97771122-97771144 CTGCACCCCCTCCCCAAGCCTGG - Intergenic
1122774244 14:104110222-104110244 CATCACCCACTCCCCAAGCCTGG - Intronic
1123676239 15:22712965-22712987 CCTCCCCCCCACCCCACAACAGG + Intergenic
1124253136 15:28120664-28120686 CCTCACACCCTCCCCACCACTGG - Intronic
1124410240 15:29430790-29430812 GACCACCCACTCCCCAAAAAAGG + Intronic
1124587868 15:31025868-31025890 CTTCACCCCCTACCCCAAAGTGG - Intronic
1126026690 15:44453573-44453595 CATCCCCCCCACCCCACGACAGG + Intronic
1128153038 15:65375402-65375424 CATCTCCCCTTCCCCAATGCAGG - Exonic
1128369275 15:67028081-67028103 AATGACACACTCCCCAAAACAGG - Intergenic
1128404893 15:67326114-67326136 CACTACCCCCACCCCACAACAGG + Intronic
1130264699 15:82389815-82389837 CCTCCCCCCCACCCCACAACAGG + Intergenic
1130792864 15:87174513-87174535 ATTCACCCCCTCCCCAAAGGAGG - Intergenic
1131409875 15:92198694-92198716 CTAGACCCCATCCCCAAAACGGG - Intergenic
1131834082 15:96373015-96373037 CATCACCCACTTCCCAAACCAGG - Intergenic
1132011319 15:98279051-98279073 CCCCACCCCCACCCCACAACAGG - Intergenic
1132147728 15:99438345-99438367 CCTCTCCCCACCCCCAAAACAGG - Intergenic
1132344938 15:101102466-101102488 CATCACCCCTTCCCCAACCCTGG + Intergenic
1132693970 16:1193999-1194021 CAGCGCCCCCTGCCCAACACGGG - Intronic
1132721770 16:1320082-1320104 CATCACCCTCCTCCCAACACTGG - Intronic
1132844474 16:1993460-1993482 CACCACCCTCGCCCCAAGACTGG + Exonic
1133536591 16:6708131-6708153 CATCCCCCGCTCCCCAAGCCAGG - Intronic
1133996673 16:10753599-10753621 CACCACTGCATCCCCAAAACAGG - Intronic
1135817203 16:25645417-25645439 CCTTACCCCCACCCCACAACAGG - Intergenic
1137248221 16:46722707-46722729 CCCCACCCCCACCCCAAAAAAGG - Intronic
1138547499 16:57728597-57728619 GATCCCCCCCTCCCCAACAAAGG - Intronic
1138866783 16:60831106-60831128 CTTTACCCCCACCCCACAACAGG - Intergenic
1140285735 16:73600931-73600953 CATAACGCCCTGCCCAAAGCAGG + Intergenic
1140588814 16:76326792-76326814 CCCCACCCCCACCCCACAACAGG - Intronic
1140926681 16:79590196-79590218 CATCCCCCCCTCCGCCAACCTGG - Intronic
1142759753 17:2035484-2035506 CCCCACCCCCTCCCCACCACAGG - Intronic
1143141725 17:4745024-4745046 CATCACCTGCTCCACAAACCTGG + Intronic
1143497155 17:7318824-7318846 CCCCTCCCCTTCCCCAAAACTGG + Intronic
1144531941 17:16047947-16047969 CATCACTCCCTCTCCAAAAATGG + Intronic
1144932534 17:18871347-18871369 CAACACCTCCACCCCAAACCAGG + Intronic
1145402405 17:22552448-22552470 AATCACCCCCTACCAAAATCAGG + Intergenic
1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG + Exonic
1146835137 17:36104705-36104727 AATCACCCCCTCCCCAAAACAGG - Intronic
1146849753 17:36211952-36211974 CATCACCCCCTCCCCAAAACAGG - Intronic
1147578226 17:41614576-41614598 CCTCACCCCTACCCCAAAAAGGG + Intronic
1147816483 17:43214318-43214340 CATGGCCCCCTCTCCAAGACAGG + Intronic
1147920556 17:43913959-43913981 CATCCACCCCTCCCCAAAAATGG + Intergenic
1149772460 17:59332136-59332158 CCGCACCCCCGCCCCAAACCTGG - Intronic
1151794475 17:76334174-76334196 CCCCACCCCCACCCCAAGACGGG - Intronic
1152356614 17:79810589-79810611 ACGCACCCCCTCCCCAAACCCGG + Intergenic
1153133533 18:1885739-1885761 CCCCACCCCCACCCCACAACAGG - Intergenic
1155249279 18:23939828-23939850 CATTCCCGCCTCCCCAAAAGAGG - Intronic
1155955321 18:31951916-31951938 CTTCCCCCCCTCCCCCAGACGGG - Intronic
1156237281 18:35217492-35217514 CATCTCCCCCTCCTCACACCCGG + Intergenic
1156295290 18:35783996-35784018 CCTCATCCCCTCCCCAACACGGG + Intergenic
1157007775 18:43606470-43606492 TTTCACCACCTCCCCAACACTGG - Intergenic
1157650876 18:49329277-49329299 CCTCCCCCCCACCCCACAACAGG - Intronic
1158926426 18:62267931-62267953 CCACACTCCCTCCCCAAAAAAGG + Intronic
1159104556 18:63990665-63990687 CCTCCCCCCCACCCCACAACAGG + Intronic
1159258377 18:65978030-65978052 AACCACCCCCTACCCAAATCTGG + Intergenic
1159432326 18:68369005-68369027 CTTCCCCACCACCCCAAAACAGG - Intergenic
1159620356 18:70630156-70630178 CATTCCCCCCACCCCACAACAGG - Intergenic
1160248368 18:77179486-77179508 AACCACCACCTCCCCAAATCAGG - Intergenic
1160622109 18:80178893-80178915 CCTCACTCCCTCCCCAGAAGAGG - Intronic
1160910858 19:1473251-1473273 CATCACCTCTTCCTCAAAATGGG + Exonic
1161061976 19:2219826-2219848 CAGTACCCCCTCCCCACAGCTGG + Intronic
1162359859 19:10212468-10212490 CACCACACCCTGCCCAAAAAAGG + Intronic
1163088360 19:14999994-15000016 CCTCCCCCCCACCCCACAACAGG + Intronic
1163112635 19:15170641-15170663 CGCCACCCCCTCCCCAAGGCAGG + Intronic
1163747331 19:19056179-19056201 AACTACCCCCTCCCCAAAAAAGG - Intronic
1166160275 19:40947599-40947621 CATCACGCCCTCCCCATCTCTGG - Intergenic
1166169161 19:41015233-41015255 CATCACGCCCTCCCCATCTCTGG - Intronic
1167389260 19:49183029-49183051 GACCAGCCCCTCCCCAACACTGG - Intronic
1167709735 19:51103190-51103212 TTTCACCCCATCCCTAAAACAGG - Intronic
1167924857 19:52813321-52813343 CTTCCCCTGCTCCCCAAAACAGG - Intronic
1168304620 19:55428825-55428847 CTCCACCCCCTCTCCAACACTGG - Exonic
925171329 2:1751947-1751969 AATAACCCCCTCCCCAACAGGGG + Intergenic
925327722 2:3036294-3036316 GATTTCCCCCTCCCCAAATCTGG + Intergenic
927102757 2:19800468-19800490 CAGCACCCCCTGCCCATGACAGG + Intergenic
928231144 2:29499951-29499973 CATCACCCAGTCACCAACACTGG + Intronic
930036174 2:47086579-47086601 CGTCACAGCATCCCCAAAACTGG - Intronic
930290430 2:49486313-49486335 CCTCCCCCCCACCCCACAACAGG - Intergenic
930993279 2:57685703-57685725 CATCCCTCCCTCCACAAGACTGG + Intergenic
931032048 2:58187408-58187430 CATCCCCCCCACCCCACGACAGG - Intronic
931343543 2:61425819-61425841 CATCACCCCTTCCCCTCGACAGG + Intronic
931684965 2:64784991-64785013 CGCCACGCCCTCCCCAAAGCTGG - Intergenic
931762799 2:65432084-65432106 CCGCCCCCCCTCCCCAAATCAGG - Exonic
931929942 2:67120841-67120863 CATCCCCCCCACCCCACAATAGG + Intergenic
932484785 2:72077635-72077657 CATCACCCCCACCCCCAGGCAGG + Intergenic
932933542 2:76073761-76073783 CATGACCCCCTACCCAACAAAGG - Intergenic
933852614 2:86382670-86382692 CACCACCCACTCCCCTAAGCTGG - Intergenic
935883166 2:107587160-107587182 CCTCCCCCCCACCCCACAACAGG - Intergenic
935918643 2:107986259-107986281 CATCTCCTCCTCCAGAAAACTGG - Intergenic
935921251 2:108017914-108017936 CATAAACCGCCCCCCAAAACTGG + Intergenic
937301927 2:120847909-120847931 CTGCACCCCCTCCCCACAGCGGG - Intronic
938929593 2:136075027-136075049 CAGGAACCCATCCCCAAAACGGG + Intergenic
939408245 2:141788686-141788708 CCCCACCCCCACCCCACAACAGG + Intronic
940894069 2:159063533-159063555 CATCCTCCCCTCCCCCAGACTGG - Intronic
941281202 2:163553706-163553728 AAACACCCCCTACCTAAAACTGG - Intergenic
944393704 2:199246207-199246229 CCTCACCCCCACCCCAAGGCTGG + Intergenic
945150158 2:206782241-206782263 GGTCAGCCCCTCCCCAAAGCCGG - Intronic
945279746 2:208025331-208025353 CCCCACCCCATCCCCCAAACTGG + Intronic
946132751 2:217620017-217620039 CATCCCCCACTCCTCAAAAAAGG + Intronic
946302122 2:218830381-218830403 CTTCCCCTCCTCCCCCAAACAGG - Exonic
946651978 2:221901962-221901984 CCTCACCCCCACCCCCCAACAGG + Intergenic
947323489 2:228948824-228948846 CCTCCCCCCCACCCCACAACAGG - Intronic
1169068169 20:2706121-2706143 CATCACACCCTCCCCAGCCCTGG - Intronic
1169266313 20:4169403-4169425 CATCACTCCCTCTCCAAGAGTGG - Intronic
1170237296 20:14120900-14120922 CCTCACCCCCCACCCATAACAGG - Intronic
1170246899 20:14231286-14231308 CACTGCCCCCACCCCAAAACAGG + Intronic
1170247356 20:14237691-14237713 CCTCCCCCCCACCCCAAAACAGG + Intronic
1170893814 20:20396637-20396659 TCCCACCCCCTCCCCAAAGCAGG + Intronic
1171141147 20:22744036-22744058 CATTATGCCATCCCCAAAACAGG + Intergenic
1172107833 20:32527405-32527427 CAGCACCCCAGCCCCAGAACAGG + Intronic
1173007454 20:39151087-39151109 CTTCACCTCCTCCCCAGAGCTGG + Intergenic
1174444594 20:50582202-50582224 CATCACCCCATCCCCATAAATGG + Intronic
1175324074 20:58110452-58110474 AATTACCCCCACCCCAGAACTGG - Intergenic
1177741240 21:25155714-25155736 CAACACCTCCTTCCCAAACCTGG + Intergenic
1179462702 21:41548404-41548426 CAGCTCCCCCTCCCCAAAAGCGG + Intergenic
1179873555 21:44255963-44255985 CCCCACCCCCTCCCCTAGACCGG - Intronic
1181000342 22:19985208-19985230 CATCACCCCCTCCCCAGCTGGGG + Intronic
1182131413 22:27855605-27855627 CCTCACCCCCACCCCGGAACCGG + Intronic
1184664490 22:45980637-45980659 AATCACCCCCTACCCACAACAGG - Intergenic
949376139 3:3392505-3392527 CATCACCCCATCCCCAGTGCTGG + Intergenic
949912885 3:8927903-8927925 CACTCCCCCCACCCCAAAACAGG - Intronic
950214744 3:11151491-11151513 CACCACCGCCCCCCCAAAAAAGG - Intronic
950349135 3:12329794-12329816 CATCACCCACTCCCCAGCCCTGG + Intronic
950829662 3:15860375-15860397 CATCACCCCCGCCCCTCACCCGG - Intergenic
951035230 3:17925538-17925560 CTGCCCCCCCTCCCCACAACAGG + Intronic
951122940 3:18949725-18949747 TAACAGCCCCTCCCCAAAATAGG + Intergenic
952132879 3:30384872-30384894 CATCACCCCTCCCCCAAACCTGG - Intergenic
952670238 3:35958169-35958191 CCCCACCCCCACCCCACAACAGG + Intergenic
953091415 3:39730121-39730143 CCTCACCCCCACCCCACAACAGG + Intergenic
956744180 3:72298564-72298586 CATCACTCTCTCCCCACAACAGG - Intergenic
956778760 3:72587961-72587983 AATCAGTCCCTCCCCAAAAGGGG + Intergenic
956861910 3:73332995-73333017 CCTCCCCCCCACCCCACAACAGG + Intergenic
957013704 3:75038291-75038313 CCTCACCCCCACCCCCTAACAGG + Intergenic
957548242 3:81668207-81668229 CTTCACCCCCACCCCACAACAGG - Intronic
957565975 3:81884111-81884133 CACTCCCCCCACCCCAAAACAGG - Intergenic
957720969 3:83999443-83999465 CACCTCCCCCACCCCACAACAGG + Intergenic
958184621 3:90105132-90105154 CCTCTCCCCCACCCCACAACAGG + Intergenic
958186377 3:90125260-90125282 CCTCCCCCCCACCCCATAACAGG - Intergenic
960069461 3:113412521-113412543 CCTCACCCCCACCCCCCAACAGG + Intronic
960565678 3:119129152-119129174 CCTCACCCCCACCCCACAACAGG - Intronic
961440616 3:126950866-126950888 CATCACTCCCTTCCCAACAATGG - Intronic
961586685 3:127934056-127934078 CACCACCCCCACCCCCAAATGGG - Intronic
962640597 3:137381775-137381797 CCTCTCCCCATCCCCACAACAGG - Intergenic
964144845 3:153447294-153447316 CCTCCCCCCCACCCCACAACAGG - Intergenic
964575407 3:158161303-158161325 GATCAGCCCCTACTCAAAACAGG + Intronic
965127350 3:164648295-164648317 CAACATCCCCTCCCCAACCCAGG - Intergenic
965889138 3:173489232-173489254 CCTTACCCCCACCCCACAACAGG + Intronic
967235786 3:187382488-187382510 CATCACTCCCTCCCCATACTGGG + Intergenic
967434529 3:189429407-189429429 CTTCACACCCTCCCAAAAAAAGG + Intergenic
967581167 3:191156356-191156378 CATTAACCCCTCCCTAAAACAGG - Intergenic
967899623 3:194436153-194436175 CCTCACCACCTCCCCCAAATAGG + Intronic
968503660 4:962304-962326 CATCATCCCCTCTGCAAAGCGGG - Intronic
969251290 4:5970408-5970430 GATTTCCCCATCCCCAAAACAGG + Intronic
969474312 4:7412667-7412689 CATCAGCCCCTCCCCACCCCTGG + Intronic
969844386 4:9908700-9908722 CACTACCCCCACCCCACAACAGG + Intronic
970066386 4:12099071-12099093 CATCAACATCACCCCAAAACTGG - Intergenic
971038958 4:22729011-22729033 CCTCACCCCCACCCCCCAACAGG - Intergenic
971442270 4:26699856-26699878 CCTTCCCCCCACCCCAAAACAGG - Intronic
973132197 4:46661612-46661634 CATCCCCCCGACCCCACAACAGG + Intergenic
973170364 4:47135223-47135245 CAACACCTTCTCCCCAAAACTGG - Intronic
974541563 4:63245127-63245149 CACTACCCCCACCCCACAACAGG + Intergenic
975430558 4:74285183-74285205 CATCCCCCTCACCCCACAACAGG - Intronic
975722252 4:77259574-77259596 CTTCCCCCCCACCCCACAACAGG - Intronic
977654689 4:99507071-99507093 CATCAGCCCCTCCCCCAAGTTGG - Intergenic
978099651 4:104821974-104821996 CACTACCCCCACCCCACAACAGG - Intergenic
978590698 4:110321966-110321988 CACCTCCCCCACCCCACAACAGG + Intergenic
978680168 4:111370361-111370383 CCCCACCCCCACCCCAAAACAGG - Intergenic
978684462 4:111422429-111422451 CACTCCCCCCACCCCAAAACAGG - Intergenic
979515489 4:121604822-121604844 CCTCTCCCCCACCCCACAACAGG + Intergenic
979816884 4:125118191-125118213 TATTAACCCCTCCCCAAATCTGG - Intergenic
981735054 4:147940538-147940560 CTTCTCCCCCACCCCAAAACAGG + Intronic
982077183 4:151749503-151749525 CCCCACCCCCACCCCACAACAGG - Intronic
983275068 4:165606964-165606986 CTTCACCCTCCCCCCACAACAGG + Intergenic
983353376 4:166623150-166623172 CATGACCCCGCCCCCAACACTGG + Intergenic
983598185 4:169494246-169494268 CACTACCCCCACCCCACAACAGG + Intronic
984109909 4:175600115-175600137 CATCCCCCCCACCCCATGACAGG + Intergenic
984779060 4:183506779-183506801 CCCCACCCCCTCCCCAAACACGG - Intronic
985109545 4:186534757-186534779 CATTCCCACCTCCCCAGAACAGG + Intronic
986310954 5:6550853-6550875 CAACACCCACTCGCCAAAAGTGG + Intergenic
987116058 5:14727771-14727793 CATCACCATCTGCCCATAACGGG - Intronic
987224859 5:15830123-15830145 CCTCATCCCTTCCCCAAACCTGG + Intronic
987269456 5:16291215-16291237 CACTACCCCCACCCCACAACAGG - Intergenic
988281114 5:29148478-29148500 CCCTACCCCCACCCCAAAACAGG + Intergenic
989143450 5:38224757-38224779 CCTCCCCCCCACCCCACAACAGG - Intergenic
989956375 5:50365834-50365856 CATCAGCCTTTCCCCCAAACTGG + Intergenic
990859831 5:60314634-60314656 CCACACCCCCACCCCACAACAGG + Intronic
990956408 5:61344524-61344546 CCTCACCCCATCCCCAAGAAAGG - Intronic
990974603 5:61548412-61548434 CAGCACCCCCTTCCCCCAACAGG + Intergenic
991422401 5:66454593-66454615 CAGCCCCGCCTCCCCCAAACTGG - Intergenic
992222460 5:74586278-74586300 CATGACCCCAGCCCCAAACCTGG - Intergenic
992330918 5:75716901-75716923 CGCCAGCCCCTCCCCAAAGCAGG + Intronic
992575734 5:78109531-78109553 AATCACCCCCTTCCTATAACTGG - Intronic
993117113 5:83732732-83732754 CCTCACCCCCTACCCCCAACAGG + Intergenic
993544964 5:89200337-89200359 CATCACCCCCTCCCAACCACAGG - Intergenic
993592111 5:89806876-89806898 CCTAACCCCCACCCCCAAACAGG - Intergenic
993605042 5:89979578-89979600 CATCAATCCCTTCCCAACACCGG + Intergenic
994184792 5:96805774-96805796 CATCGCCCCTGCCCCAAGACGGG + Intronic
994369836 5:98955441-98955463 CCTCCCCCCCACCCCACAACAGG + Intergenic
994526232 5:100908427-100908449 CCTCCCCCCCACCCCACAACAGG + Intergenic
994709021 5:103243422-103243444 CATCACCACCACCCCGGAACTGG + Intergenic
995431902 5:112088742-112088764 CCTCCCCCCCACCCCACAACAGG + Intergenic
995684813 5:114760766-114760788 CCTCACCCCCACCCCACAACAGG + Intergenic
995705886 5:114989381-114989403 CACCACCCCCCCCCAAAAATAGG + Intergenic
996175656 5:120353047-120353069 CCCCACCCCCACCCCACAACAGG - Intergenic
996436325 5:123436672-123436694 CATCTCCCCCCCCCCCAAATAGG + Intergenic
996572258 5:124944966-124944988 CATCTCCTTCTCCCCAAAATAGG - Intergenic
997229811 5:132234141-132234163 CCACTCCCCTTCCCCAAAACAGG - Intronic
998694485 5:144623960-144623982 CCCCACTCCCACCCCAAAACAGG + Intergenic
999055351 5:148569349-148569371 CTTCTCCCCGTCCCCCAAACAGG - Intronic
999820886 5:155227125-155227147 CGACACCCCCACCCCACAACAGG - Intergenic
1001285889 5:170423788-170423810 CCTCACCCCCTCCCCTCCACAGG + Intronic
1001430296 5:171655611-171655633 CCCCACCCCCACCCCACAACAGG - Intergenic
1001536629 5:172502740-172502762 CACCACCTCCTCCTCAAAAGCGG - Intergenic
1002715476 5:181224134-181224156 CATCCTCCCCACCCCACAACTGG - Exonic
1002819440 6:711101-711123 CATAACCCCCTCCCCGCCACGGG + Intergenic
1003392400 6:5725212-5725234 CATCACGCCATCCCCAAAACAGG - Intronic
1004340340 6:14802935-14802957 CCCAACCCCCTCACCAAAACTGG - Intergenic
1004717708 6:18234180-18234202 CGTCCCCCCCACCCCACAACAGG - Intronic
1005177637 6:23064809-23064831 CCTCCCCCCCACCCCACAACAGG - Intergenic
1006455876 6:34131613-34131635 CCTCACCCCCACCCCAACACTGG + Intronic
1007236469 6:40394104-40394126 CATCAGACCCTCCCCAAAGGTGG - Intronic
1007267263 6:40606133-40606155 CACCAACCCTTCCCCAAAGCTGG + Intergenic
1007302180 6:40875868-40875890 CAGCCTCCCCTCCCCAGAACTGG + Intergenic
1007397390 6:41585548-41585570 CCTCACCCCCTGCCCAGAGCTGG + Intronic
1007760146 6:44128414-44128436 CGGCGCCCCCTCCCCACAACAGG - Intronic
1007864130 6:44949233-44949255 CATTCCCCCCACCCCACAACGGG - Intronic
1010692352 6:78925162-78925184 CCATACCCCCACCCCAAAACAGG - Intronic
1010877301 6:81123396-81123418 CCTCCCCCCCACCCCACAACAGG + Intergenic
1011087043 6:83552456-83552478 CCTCCCCCCCACCCCACAACAGG - Intergenic
1011533499 6:88351088-88351110 GGTCACTCCCACCCCAAAACTGG + Intergenic
1011701471 6:89959179-89959201 CATCACCCCCTCCTCAAATCAGG - Intronic
1012220541 6:96643310-96643332 CACTACCCCCACCCCACAACAGG - Intergenic
1012327169 6:97935757-97935779 AATCTCCCCCACCCCAAACCAGG - Intergenic
1012772856 6:103461682-103461704 CCTTACCCCCACCCCACAACAGG - Intergenic
1013365519 6:109434802-109434824 CATCCCACCCTCCCCAACACAGG + Intronic
1013449436 6:110264965-110264987 CACTACCCCCACCCCACAACAGG - Intronic
1013711810 6:112909690-112909712 CAGCACCCCCACCCCACAACAGG - Intergenic
1014127532 6:117794251-117794273 GAGCACCCCCTCCCCAGAATTGG + Intergenic
1014737692 6:125113187-125113209 TATCACCCCCTCCAGAGAACAGG - Intergenic
1014973450 6:127848067-127848089 CCTCCCCCCCACCCCACAACAGG + Intronic
1016987378 6:149905468-149905490 CATCACCTCCTCCCCAGAGAGGG - Intergenic
1017145380 6:151229984-151230006 CCTCACCCCCACCCCACAAAGGG + Intergenic
1018054677 6:160041473-160041495 CCTCACCCCCAACCCTAAACAGG - Intronic
1018315277 6:162550452-162550474 CATCTGCCCATCCCCCAAACGGG - Intronic
1019351290 7:555208-555230 CCTCAGCCCCTCCCCAGAGCGGG - Intronic
1019610897 7:1936156-1936178 CAGCACCACCTCCCCACATCAGG + Intronic
1019933748 7:4240889-4240911 CCTCAGCCCCTCCCTAACACGGG - Intronic
1020048094 7:5058688-5058710 CATTTCCCCTTCCCCATAACTGG + Intronic
1022093215 7:27121768-27121790 CAGCAGCCCCTCCCCCAAACAGG + Intronic
1022400201 7:30028878-30028900 CGTGACCCCCTCCCTAAGACGGG - Intronic
1023405201 7:39826540-39826562 CTACACCCCTTCCCCAAACCTGG + Intergenic
1023887147 7:44367444-44367466 CCTTACCCCATCCCCAAACCAGG + Intergenic
1024009999 7:45259297-45259319 CATCCTGCCCTCCCCAAAATGGG + Intergenic
1024754863 7:52518014-52518036 AATCACCCCATCCCCAAACTAGG + Intergenic
1026470700 7:70692659-70692681 CATCACCCCCTCCCCCAAACTGG - Intronic
1026728597 7:72892029-72892051 CATTTCCCCTTCCCCATAACTGG + Intronic
1027115177 7:75473434-75473456 CATTTCCCCTTCCCCATAACTGG - Intronic
1027757295 7:82230177-82230199 CACCACAGCCTCCCCAAAACAGG + Intronic
1027792837 7:82654827-82654849 CACCTCCCCCACCCCACAACAGG - Intergenic
1027967938 7:85038039-85038061 CCTCCCCCCCACCCCACAACAGG - Intronic
1028471797 7:91213884-91213906 CCTCCCCCCCACCCCACAACAGG + Intergenic
1029045979 7:97629224-97629246 CCTCCCCCCCACCCCACAACAGG - Intergenic
1029046775 7:97638488-97638510 CTTCAACCCCGCCCCAAATCAGG - Intergenic
1029441756 7:100590615-100590637 CATCCCTCACTCCCCAAACCTGG + Intronic
1029456722 7:100675508-100675530 CCTCCCGCCCTCCCCAGAACCGG - Intronic
1029722366 7:102377251-102377273 CATTTCCCCTTCCCCATAACTGG + Intronic
1030154189 7:106436615-106436637 CACTACCCCCATCCCAAAACAGG + Intergenic
1031302633 7:120082018-120082040 CACTACCCCCACCGCAAAACAGG - Intergenic
1032257931 7:130311794-130311816 CCTCATCTCCTCCCCCAAACTGG + Intronic
1033448534 7:141442256-141442278 CATCACCTCCTCCCCGAATCAGG + Intronic
1034114648 7:148573585-148573607 CATCACCCCCCACCCCCAACAGG + Intergenic
1036679547 8:10861051-10861073 CATTCCCCCCTCCGCAAATCTGG - Intergenic
1036704237 8:11034746-11034768 CATCACCCCTTCCCCATCAGAGG - Intronic
1037315497 8:17595707-17595729 CAGCACCCCCGCCCCACCACAGG - Intronic
1038708140 8:29915336-29915358 CCTCACCCCCTACCCCCAACAGG - Intergenic
1040774818 8:51029274-51029296 CATCCCCCCCACCCCACAACAGG + Intergenic
1041066415 8:54086477-54086499 CATCCCCCCCGCCCAAAAAAAGG + Intronic
1042637608 8:70895205-70895227 CACCACCCCATCCCCCAAATGGG - Intergenic
1042841121 8:73124883-73124905 CATCTCCCCATCCCCTAACCCGG + Intergenic
1044981101 8:97717620-97717642 TATCCCCCCCCCCCCAAAAATGG + Intronic
1045161041 8:99544306-99544328 CCTGACCCCCACCCCACAACAGG - Intronic
1045389298 8:101699753-101699775 CTTGACCCCCACCCCACAACTGG - Intronic
1046468734 8:114640265-114640287 CCTTCCCCCCACCCCAAAACAGG + Intergenic
1047471022 8:125172515-125172537 GCTCTCCCCCTCCCCAAAAGGGG + Intronic
1048837784 8:138537624-138537646 CCTCCCCCCCACCCCACAACAGG - Intergenic
1049004266 8:139844923-139844945 CATCACCCCGTCCCCAGGCCTGG + Intronic
1049594011 8:143475254-143475276 CCTGACCTCCTCCCCAAGACAGG + Intronic
1049716092 8:144093353-144093375 CCTCTCCCCCACCCCACAACAGG + Intergenic
1051565828 9:18496989-18497011 CACCCTCCACTCCCCAAAACAGG - Intronic
1052627698 9:30999082-30999104 CACTACCCCCACCCCACAACAGG + Intergenic
1053201288 9:36153247-36153269 CAGCACTCCCACTCCAAAACAGG + Intronic
1053293482 9:36897337-36897359 GATCGACCCCTCCCCCAAACTGG - Intronic
1055502338 9:76913863-76913885 CCTCACCCCTTCCCAAAAAGTGG + Intergenic
1055617568 9:78088886-78088908 CATCACCCCAACCCCATGACAGG - Intergenic
1056143461 9:83707279-83707301 CATCAGCCCGTCCCACAAACAGG + Intronic
1057851150 9:98567873-98567895 CAACACCACCACCCCAAAAGAGG - Intronic
1058791271 9:108448170-108448192 CCCCACCCCCACCCCACAACAGG - Intergenic
1060017862 9:120102600-120102622 CACCTCCCCCACCCCACAACAGG - Intergenic
1060508464 9:124215481-124215503 CATCAGACCCTCCCCAGGACAGG - Intergenic
1060610460 9:124959683-124959705 CATCCCCCCCACCCCACAATAGG + Intronic
1060721143 9:125979361-125979383 CACTACCCCCACCCCACAACAGG + Intergenic
1060889410 9:127178599-127178621 TATCACCCCCACCCCCAATCAGG + Intronic
1061041689 9:128144492-128144514 CATGTCCCCCTCCCCCAAAGAGG + Intergenic
1061364830 9:130167107-130167129 CATCACCCCCTCTCTGAACCTGG + Intergenic
1061540236 9:131274444-131274466 CAGCACCCCCTCCCCCGAACTGG + Intronic
1062494369 9:136824877-136824899 CATCAGCCTCACCCCAAACCAGG - Intronic
1185909674 X:3970312-3970334 CATCATCCCCTTTACAAAACAGG + Intergenic
1186206852 X:7209773-7209795 CGTCACCCCCACCCCCAAATAGG + Intergenic
1186933258 X:14418276-14418298 CTCCCCCCCCTCCCCACAACAGG + Intergenic
1187298465 X:18025561-18025583 ACTCACCCCCACCCCAAACCTGG - Intergenic
1187803768 X:23095772-23095794 CATCCCTCCCTCCACAAGACTGG + Intergenic
1188323141 X:28765146-28765168 CCCCACCCCCACCCCACAACAGG - Intronic
1189371234 X:40431323-40431345 CAGCAGCCCCTCCCCATCACAGG + Intergenic
1189911493 X:45814688-45814710 CACCATCCCTTCACCAAAACAGG + Intergenic
1190875753 X:54459066-54459088 CATCTCCCCCACCCCAAGGCAGG + Intronic
1190995161 X:55600680-55600702 CTTGACCCCCACCCCACAACAGG + Intergenic
1191015540 X:55806213-55806235 CATTCCCCCCACCCCACAACAGG + Intergenic
1191595329 X:62937377-62937399 CCTCACCCCCACTCCACAACAGG + Intergenic
1191664053 X:63680332-63680354 CATCACCCCGTCCCCATAGCTGG + Intronic
1191893368 X:65967510-65967532 CCTCTCCCCCACCCCACAACAGG - Intergenic
1191958232 X:66669769-66669791 CCTCACCCCCACCCCCCAACAGG + Intergenic
1192011005 X:67272400-67272422 CCTCCCCCCCACCCCACAACAGG - Intergenic
1193031369 X:76901663-76901685 CCTCCACCCCTCCCCACAACAGG - Intergenic
1193339167 X:80325419-80325441 CCATACCCCCACCCCAAAACAGG - Intergenic
1193400164 X:81032816-81032838 CATCCCCCCCACCCCAAAACAGG - Intergenic
1193474476 X:81946260-81946282 CATTCCCCCCACCCCACAACAGG - Intergenic
1193829364 X:86269955-86269977 CTTCACCCACTCCTCAAAGCAGG + Intronic
1195053150 X:101116825-101116847 CATCACATCCTCACCAATACTGG + Intronic
1195744801 X:108105874-108105896 CATCAGCCCCTCTCCCAAGCTGG - Intronic
1195787393 X:108542255-108542277 CCCCACCCCCACCCCACAACAGG + Intronic
1195816722 X:108896499-108896521 CATCAGCCCCCCCCCATTACAGG + Intergenic
1196140976 X:112263046-112263068 CCTCCCCCCAACCCCAAAACAGG - Intergenic
1198149983 X:133898750-133898772 CATAAACTCCTCCCCAAAACAGG - Intronic
1198496875 X:137202216-137202238 CATCACTCCTTTCCCAACACAGG + Intergenic
1198652095 X:138873996-138874018 CCTCCCCCCCACCCCACAACAGG - Intronic
1200395631 X:155985483-155985505 GCTCTCCCCCTCCCCAAAGCAGG + Intergenic
1201587059 Y:15572653-15572675 CTCCTCCCCCACCCCAAAACAGG - Intergenic
1201632191 Y:16081089-16081111 CTTCACCCCCTCACCAAACTTGG + Intergenic
1201796349 Y:17900620-17900642 CACGCCCCCCACCCCAAAACAGG - Intergenic
1201805206 Y:18005365-18005387 CACGCCCCCCACCCCAAAACAGG + Intergenic
1202357745 Y:24069686-24069708 CACGCCCCCCACCCCAAAACAGG - Intergenic
1202513033 Y:25600427-25600449 CACGCCCCCCACCCCAAAACAGG + Intergenic