ID: 1146854880

View in Genome Browser
Species Human (GRCh38)
Location 17:36254100-36254122
Sequence GGCTGAACACCCTGCGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 13, 1: 1, 2: 0, 3: 7, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146854880_1146854893 14 Left 1146854880 17:36254100-36254122 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1146854893 17:36254137-36254159 CAGCTGGTCCTCCTGGGATATGG 0: 13
1: 3
2: 3
3: 25
4: 229
1146854880_1146854886 -10 Left 1146854880 17:36254100-36254122 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1146854886 17:36254113-36254135 GTGTTCAGCCTGCCAGCAGGGGG 0: 14
1: 1
2: 4
3: 25
4: 202
1146854880_1146854894 19 Left 1146854880 17:36254100-36254122 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1146854894 17:36254142-36254164 GGTCCTCCTGGGATATGGCACGG 0: 15
1: 0
2: 0
3: 14
4: 144
1146854880_1146854890 7 Left 1146854880 17:36254100-36254122 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1146854890 17:36254130-36254152 AGGGGGCCAGCTGGTCCTCCTGG 0: 12
1: 2
2: 6
3: 24
4: 328
1146854880_1146854891 8 Left 1146854880 17:36254100-36254122 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1146854891 17:36254131-36254153 GGGGGCCAGCTGGTCCTCCTGGG 0: 12
1: 2
2: 5
3: 46
4: 359
1146854880_1146854888 -2 Left 1146854880 17:36254100-36254122 CCCGCTCCGCAGGGTGTTCAGCC 0: 13
1: 1
2: 0
3: 7
4: 122
Right 1146854888 17:36254121-36254143 CCTGCCAGCAGGGGGCCAGCTGG 0: 12
1: 3
2: 4
3: 38
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146854880 Original CRISPR GGCTGAACACCCTGCGGAGC GGG (reversed) Exonic