ID: 1146856010

View in Genome Browser
Species Human (GRCh38)
Location 17:36258877-36258899
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 14, 1: 1, 2: 5, 3: 3, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146856010_1146856014 -7 Left 1146856010 17:36258877-36258899 CCTCCTGGGGCGACTCCTTCATC 0: 14
1: 1
2: 5
3: 3
4: 100
Right 1146856014 17:36258893-36258915 CTTCATCCTCCAAGTCTCCAGGG 0: 18
1: 0
2: 5
3: 29
4: 280
1146856010_1146856015 -4 Left 1146856010 17:36258877-36258899 CCTCCTGGGGCGACTCCTTCATC 0: 14
1: 1
2: 5
3: 3
4: 100
Right 1146856015 17:36258896-36258918 CATCCTCCAAGTCTCCAGGGTGG 0: 17
1: 0
2: 4
3: 22
4: 214
1146856010_1146856013 -8 Left 1146856010 17:36258877-36258899 CCTCCTGGGGCGACTCCTTCATC 0: 14
1: 1
2: 5
3: 3
4: 100
Right 1146856013 17:36258892-36258914 CCTTCATCCTCCAAGTCTCCAGG 0: 18
1: 1
2: 2
3: 36
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146856010 Original CRISPR GATGAAGGAGTCGCCCCAGG AGG (reversed) Intronic
902613198 1:17609122-17609144 CATGCAGGAATGGCCCCAGGTGG - Intronic
902856492 1:19210092-19210114 GATGAAGGAGTTGCCGCAGCTGG - Exonic
903775401 1:25790150-25790172 AATGTAGGAGTTGACCCAGGAGG - Intergenic
906060399 1:42944687-42944709 GAAGAAGGCTTCGGCCCAGGAGG + Intronic
912853009 1:113143341-113143363 GAATAGGGAGTAGCCCCAGGAGG + Intergenic
914719967 1:150281823-150281845 GATGGAGGAGCCGCCCCAGCGGG + Intergenic
917534407 1:175863967-175863989 GATAGAGGAGTCGCTCGAGGAGG + Intergenic
922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG + Intronic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1071121865 10:82287737-82287759 GGTGAAGGAGTGGCCACAGCTGG + Intronic
1071767648 10:88686776-88686798 GATGCAGAAGTGGACCCAGGTGG + Intergenic
1073568954 10:104559841-104559863 GATTCAGGAGTGGCTCCAGGAGG + Intergenic
1075413942 10:122248947-122248969 GATGCAGGTGTAACCCCAGGCGG - Intronic
1075715801 10:124554636-124554658 GCTGAAGGGGTGGGCCCAGGTGG + Intronic
1080779799 11:35419565-35419587 GTTAAAGGAGTTGCCCGAGGCGG - Intronic
1081869962 11:46378939-46378961 GAAGGAGGGGTGGCCCCAGGAGG + Intronic
1083664609 11:64267711-64267733 CAGGAAGGAGGGGCCCCAGGAGG - Intronic
1083717530 11:64586417-64586439 GAAGAAGGGGTTCCCCCAGGAGG - Intergenic
1084564097 11:69919897-69919919 GAAGGAGGACTCACCCCAGGAGG - Intergenic
1084564277 11:69920525-69920547 GAGGGAGGACTCACCCCAGGAGG - Intergenic
1089771939 11:120809238-120809260 GATGAAGAAGTCCCTCCATGGGG + Intronic
1093521186 12:20051921-20051943 GATGAAGGAGTCAGTGCAGGAGG + Intergenic
1107851312 13:44576175-44576197 GAAGGAGGAATCGCGCCAGGCGG - Exonic
1120397665 14:83988394-83988416 GAAGAAGGAGCACCCCCAGGAGG - Intergenic
1122501378 14:102202260-102202282 GAGGAAGGAGCTGCCACAGGAGG - Intronic
1122600309 14:102918045-102918067 GAGGAAGGAGCCGCCACTGGGGG - Intergenic
1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG + Intronic
1127238184 15:57079642-57079664 GGTGAATGAGTAGCCCCTGGCGG + Intronic
1129270620 15:74417558-74417580 GCTGGAGCAGGCGCCCCAGGGGG - Intronic
1130922184 15:88356999-88357021 GGGGAAGGAGTTACCCCAGGAGG + Intergenic
1131076639 15:89499385-89499407 CATCAAGGAGTCCCCCAAGGGGG - Intergenic
1136683956 16:31983408-31983430 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136784582 16:32926960-32926982 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136885201 16:33926846-33926868 CATGGAGGAGGTGCCCCAGGAGG + Intergenic
1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG + Intronic
1137946778 16:52740653-52740675 GATGAAGGTATCACCCCAAGTGG + Intergenic
1140970480 16:80007703-80007725 GATGCAGGAGTCTACCCAGTTGG + Intergenic
1142160252 16:88553868-88553890 GAGGAAGGAGTCAGCCCCGGTGG + Intergenic
1142194483 16:88733149-88733171 GATGGAGGACTCTCCCCTGGGGG - Intronic
1203087241 16_KI270728v1_random:1190966-1190988 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG + Intronic
1144494873 17:15739727-15739749 GATGAAGGAGCCGCTCTGGGAGG + Intronic
1144905382 17:18636945-18636967 GATGAAGGAGCCGCTCTGGGAGG - Intronic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1145841892 17:28002037-28002059 GATGGAGGAGCTGACCCAGGAGG + Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147144881 17:38479111-38479133 CATGGAGGAGGTGCCCCAGGAGG - Intronic
1147170557 17:38616455-38616477 GATGAAGGCCTGGCACCAGGGGG + Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149985776 17:61345762-61345784 AGTGAAGGAGTGGCACCAGGAGG + Intronic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150285498 17:63951621-63951643 GAAGAAGGAGCCGCCCGAGGAGG - Exonic
1150723966 17:67636635-67636657 TACGAGGGAGTCGCCCCTGGGGG - Intronic
1151718237 17:75842435-75842457 GATGAAGGTCTCGTCCCAGACGG + Exonic
1152508576 17:80770141-80770163 GATGCAGCAGTCCTCCCAGGAGG - Intronic
1155994960 18:32321436-32321458 GATAGAGGAGTTCCCCCAGGAGG - Intronic
1163219183 19:15902385-15902407 GATGAAGGAGACACTGCAGGTGG - Intergenic
1165365162 19:35360745-35360767 GATGAAGGAGTGGCCCAGAGAGG + Intergenic
1165366980 19:35373213-35373235 GATGAAGGAGTGGCCCAGAGAGG + Intergenic
1165866069 19:38939818-38939840 GGTGAAGGAGTGGCCTGAGGCGG + Intronic
1166689164 19:44812527-44812549 GATGGAGGACTCTGCCCAGGAGG + Exonic
925232166 2:2243081-2243103 AATGAAGGAAGGGCCCCAGGTGG + Intronic
927089839 2:19701933-19701955 AACCAAGGAGTCCCCCCAGGTGG + Intergenic
927973674 2:27322164-27322186 GATAAAGGCATTGCCCCAGGAGG - Intronic
938212881 2:129483376-129483398 GATGAAGGAGTTGCCCCTCAAGG + Intergenic
946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG + Intronic
948668426 2:239551000-239551022 GATGACGCAGCCTCCCCAGGTGG - Intergenic
1169141593 20:3229988-3230010 GGTGACGGGGCCGCCCCAGGTGG - Intronic
1173643875 20:44621792-44621814 GGAGAAGCAGTGGCCCCAGGAGG - Intronic
1176297343 21:5081125-5081147 GAGGAAGGAGTGGGCCCTGGAGG - Intergenic
1179030959 21:37719087-37719109 GATGAAGGAGGAGCCCCGAGGGG + Intronic
1179826412 21:43968590-43968612 GCTCAAAGAGACGCCCCAGGAGG - Intronic
1179859686 21:44180823-44180845 GAGGAAGGAGTGGGCCCTGGAGG + Intergenic
1180075729 21:45460526-45460548 GATGAAGGAGCAGCCCCTCGGGG - Intronic
1180183995 21:46130527-46130549 GATGAAGGATCCTCCACAGGAGG + Intronic
1183993784 22:41617997-41618019 GAGGAAGAAGTAGCCACAGGAGG - Intronic
1184331751 22:43832150-43832172 GATGAAGGTGTAGCCCAAGCAGG - Intronic
1185039139 22:48495539-48495561 GATGGAGGAGCCTCCCCAGATGG - Intronic
1185253349 22:49817217-49817239 GGTCAAGGAGTCACCCCTGGAGG + Intronic
950287899 3:11759459-11759481 GTTGAAGGAGTTCCCTCAGGAGG - Intergenic
954456216 3:50601136-50601158 GGTGGAGGACACGCCCCAGGGGG - Intergenic
958449768 3:94259149-94259171 AATGAGGGAGGGGCCCCAGGTGG - Intergenic
962313713 3:134344744-134344766 GATGAGGAAGTCCCTCCAGGTGG - Intergenic
966055119 3:175677615-175677637 GATGAAGGAGTCCCTGGAGGGGG - Intronic
966882435 3:184357922-184357944 AATGAAGGAGTCCCTCCTGGTGG - Intronic
968850653 4:3075245-3075267 GGGGAAGGCCTCGCCCCAGGAGG - Intronic
969601677 4:8180024-8180046 GCTGAAAGTGTCGCCCCATGTGG + Intergenic
971382042 4:26107933-26107955 GATGAAGCAGGAGCCCAAGGAGG - Intergenic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
979659517 4:123237788-123237810 GATGAACTAGTCACCCCAGTTGG - Intronic
980784306 4:137532581-137532603 GCTGATGGAGTCACCCAAGGAGG + Intergenic
985645705 5:1083803-1083825 GATGAAGTACTCGTCACAGGCGG + Exonic
985851711 5:2393298-2393320 GCTGAAGGATTCGCCTCTGGAGG - Intergenic
989168988 5:38456822-38456844 GAGGAGGGAGTCATCCCAGGTGG + Intronic
998261248 5:140633390-140633412 GATGACTCAGGCGCCCCAGGCGG + Exonic
998544199 5:143012284-143012306 ACTGAAGGAGTCGCCCAAGAAGG - Intronic
1001959594 5:175872158-175872180 GAGGAGGGAGTCGCCCCCAGGGG + Intronic
1003524587 6:6887036-6887058 GCTGAAGGAGCCCCACCAGGTGG - Intergenic
1011643185 6:89433574-89433596 GAAGAGGGAGGCGCCCCGGGGGG - Intronic
1013992045 6:116265174-116265196 GTGGAAGGAGTGGCCCCAGATGG + Intronic
1015813780 6:137186773-137186795 GTCAAAGGAGTCGCCCCAGAAGG - Intergenic
1023703139 7:42912046-42912068 GATGCAGGAGGTGCCCGAGGCGG - Exonic
1025812179 7:64882324-64882346 GACCACGGAGACGCCCCAGGAGG + Intronic
1032472011 7:132185387-132185409 GATGAAGGTGTCGGTGCAGGTGG - Exonic
1035434363 7:158848514-158848536 GTTAAAGGACTCGCCCCAGAAGG + Intergenic
1044132364 8:88540028-88540050 GAGGATGGAGTTGCCCCAGAAGG - Intergenic
1045179575 8:99765622-99765644 GATGCAGAAGTGCCCCCAGGGGG + Intronic
1049224213 8:141441912-141441934 CAGGAGGGAGTAGCCCCAGGGGG - Intergenic
1056626840 9:88260729-88260751 GACGAGGGAATGGCCCCAGGTGG + Intergenic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic