ID: 1146864610

View in Genome Browser
Species Human (GRCh38)
Location 17:36329498-36329520
Sequence GATGAAGGAGTCGCCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 14, 1: 1, 2: 5, 3: 3, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146864607_1146864610 -8 Left 1146864607 17:36329483-36329505 CCTGGAGACTTGGAGGATGAAGG 0: 18
1: 1
2: 2
3: 36
4: 298
Right 1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG 0: 14
1: 1
2: 5
3: 3
4: 100
1146864606_1146864610 -7 Left 1146864606 17:36329482-36329504 CCCTGGAGACTTGGAGGATGAAG 0: 18
1: 0
2: 5
3: 29
4: 280
Right 1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG 0: 14
1: 1
2: 5
3: 3
4: 100
1146864605_1146864610 -4 Left 1146864605 17:36329479-36329501 CCACCCTGGAGACTTGGAGGATG 0: 17
1: 0
2: 4
3: 22
4: 214
Right 1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG 0: 14
1: 1
2: 5
3: 3
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146864610 Original CRISPR GATGAAGGAGTCGCCCCAGG AGG Intronic