ID: 1146865740

View in Genome Browser
Species Human (GRCh38)
Location 17:36334276-36334298
Sequence GGCTGAACACCCTGCGGAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 13, 1: 1, 2: 0, 3: 7, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146865727_1146865740 14 Left 1146865727 17:36334239-36334261 CCATATCCCAGGAGGACCAGCTG 0: 13
1: 3
2: 3
3: 25
4: 229
Right 1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG 0: 13
1: 1
2: 0
3: 7
4: 122
1146865730_1146865740 7 Left 1146865730 17:36334246-36334268 CCAGGAGGACCAGCTGGCCCCCT 0: 12
1: 2
2: 6
3: 24
4: 328
Right 1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG 0: 13
1: 1
2: 0
3: 7
4: 122
1146865729_1146865740 8 Left 1146865729 17:36334245-36334267 CCCAGGAGGACCAGCTGGCCCCC 0: 12
1: 2
2: 5
3: 46
4: 359
Right 1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG 0: 13
1: 1
2: 0
3: 7
4: 122
1146865734_1146865740 -10 Left 1146865734 17:36334263-36334285 CCCCCTGCTGGCAGGCTGAACAC 0: 14
1: 1
2: 4
3: 25
4: 202
Right 1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG 0: 13
1: 1
2: 0
3: 7
4: 122
1146865726_1146865740 19 Left 1146865726 17:36334234-36334256 CCGTGCCATATCCCAGGAGGACC 0: 15
1: 0
2: 0
3: 14
4: 144
Right 1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG 0: 13
1: 1
2: 0
3: 7
4: 122
1146865732_1146865740 -2 Left 1146865732 17:36334255-36334277 CCAGCTGGCCCCCTGCTGGCAGG 0: 12
1: 3
2: 4
3: 38
4: 468
Right 1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG 0: 13
1: 1
2: 0
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146865740 Original CRISPR GGCTGAACACCCTGCGGAGC GGG Exonic